- Research article
- Open Access
Dorsal horn-enriched genes identified by DNA microarray, in situ hybridization and immunohistochemistry
https://doi.org/10.1186/1471-2202-3-11
© Sun et al; licensee BioMed Central Ltd. 2002
- Received: 24 May 2002
- Accepted: 20 August 2002
- Published: 20 August 2002
Abstract
Background
Neurons in the dorsal spinal cord play important roles in nociception and pain. These neurons receive input from peripheral sensory neurons and then transmit the signals to the brain, as well as receive and integrate descending control signals from the brain. Many molecules important for pain transmission have been demonstrated to be localized to the dorsal horn of the spinal cord. Further understanding of the molecular interactions and signaling pathways in the dorsal horn neurons will require a better knowledge of the molecular neuroanatomy in the dorsal spinal cord.
Results
A large scale screening was conducted for genes with enriched expression in the dorsal spinal cord using DNA microarray and quantitative real-time PCR. In addition to genes known to be specifically expressed in the dorsal spinal cord, other neuropeptides, receptors, ion channels, and signaling molecules were also found enriched in the dorsal spinal cord. In situ hybridization and immunohistochemistry revealed the cellular expression of a subset of these genes. The regulation of a subset of the genes was also studied in the spinal nerve ligation (SNL) neuropathic pain model. In general, we found that the genes that are enriched in the dorsal spinal cord were not among those found to be up-regulated in the spinal nerve ligation model of neuropathic pain. This study also provides a level of validation of the use of DNA microarrays in conjunction with our novel analysis algorithm (SAFER) for the identification of differences in gene expression.
Conclusion
This study identified molecules that are enriched in the dorsal horn of the spinal cord and provided a molecular neuroanatomy in the spinal cord, which will aid in the understanding of the molecular mechanisms important in nociception and pain.
Keywords
- Spinal Cord
- Dorsal Horn
- Dorsal Horn Neuron
- Spinal Nerve Ligation
- Dorsal Spinal Cord
Background
The dorsal horn of the spinal cord plays important roles in sensory information processing. The dorsal horn contains the neural circuitry conveying nociceptive information, including pain and temperature, from the periphery by the primary afferents [1–3]. Nociceptive afferent fibers terminate predominately in the dorsal horn of the spinal cord. Activation of the nociceptors transmits afferent messages to the spinal cord dorsal horn through neurotransmitters such as glutamate. Initial processing of nociceptive information occurs in the spinal cord dorsal horn by excitatory and inhibitory interneurons. The projecting neurons, spinalthalamic tract cells, then convey primary nociceptive information to higher centers, signaling localization and encoding the character of the nociceptive input. Other inputs related to the subjective components of pain and related to motor and autonomic control are also relayed to higher centers. The projection neurons of the dorsal horn also activate the descending control system, which in turn controls the gain of dorsal horn neurons either through excitatory or inhibitory mechanisms. In this manner, the initial nociceptive information may be further modulated by signals descending from higher centers [1–3].
The dorsal horn can be subdivided into six distinct laminae on the basis of the cytological features of its resident neurons [2, 4]. Classes of primary afferent neurons that convey distinct modalities terminate in distinct laminae of the dorsal horn. Thus, there is a close correspondence between the functional and anatomical organization of the neurons in the dorsal horn of the spinal cord. Nociceptive neurons are mostly located in the superficial dorsal horn, in the marginal layer (lamina I) and in the substantia gelatinosa (lamina II), and receive direct synaptic input from Aδ and C fibers. Laminae III and IV are located ventral to the substantia gelatinosa and contain neurons that receive monosynaptic input from Aβ fibers. Lamina V primarily contains wide-dynamic-range neurons that project to the brain stem and to regions of the thalamus. These neurons receive monosynaptic input from Aδ and Aβ fibers. They also receive input from C-fibers, either directly on their dendrites, or indirectly via interneurons. Many neurons in lamina V also receive nociceptive input from visceral structures. Neurons in lamina VI receive input from large-diameter afferents from muscles and joints and respond to nonnoxious manipulations of joints. These neurons are thought not to contribute to the transmission of nociceptive messages.
Consistent with the important role of the dorsal horn of the spinal cord in pain transmission and modulation, neurochemical studies have implicated an enriched expression of neurotransmitters, neuropeptides, ion channels, and receptors in these neurons, including substance P, enkephalin, CGRP, somatostatin, and GABA. The morphology of primary afferent central terminals, dorsal horn neurons, and descending systems, together with their chemical neuroanatomy, synaptic arrangements, transmitter systems, and functional properties have been extensively documented [1–5]. However, the molecular/chemical neuroanatomy of the dorsal horn is a subject that is constantly being revised and updated as improved techniques reveal new insights into classical pathways or substances that are localized in the spinal cord. In this study, we performed a large-scale screening for genes that are enriched in the dorsal spinal cord. In addition to molecules that are known to be highly expressed in the dorsal spinal cord, we identified other neuropeptides, ion channels, and signaling molecules enriched in the dorsal spinal cord. We then further characterized the cellular localization of a subset of these genes in the spinal cord, as well as the regulation of a subset of the genes in a neuropathic pain model.
Results
Global identification of genes that are enriched in the dorsal spinal cord using DNA microarray analysis
Confirmation and comparison of ANOVA and paired t-test for microarray analysis.
Accession# | Description | D vs V Ratio | Confirmation | PANOVA | Ppair | Reference |
---|---|---|---|---|---|---|
K02248 | Somatostatin | 11.1 | literature | <0.05 | <0.05 | |
S49491 | Proenkephalin | 4.9 | literature | <0.05 | <0.05 | |
L09119 | Neurogranin | 4.1 | literature | <0.05 | <0.05 | [29] |
AF058795 | GABA b2 | 2.8 | literature | <0.05 | <0.05 | [30] |
AB004267 | CAMK I b2 | 2.7 | literature | <0.05 | <0.05 | [31] |
M15880 | NPY | 2.4 | literature | <0.05 | <0.05 | |
X04139 | PKC | 2.3 | literature | <0.05 | <0.05 | |
M25890 | Somatostatin | 12.4 | literature | <0.05 | <0.05 | |
X56306 | Protachykinin | 6.5 | literature | <0.05 | <0.05 | |
M15191 | Beta-tachykinin | 5.0 | literature | <0.05 | <0.05 | |
X55812 | Cannabinoid receptor | 2.9 | literature | <0.05 | <0.05 | [36] |
M16410 | Neurokinin B | 2.3 | literature | <0.05 | <0.05 | |
X62840 | K channel Kv 3.1 | 2.2 | literature | <0.05 | <0.05 | [38] |
S79730 | Nociceptin | 2.1 | literature | <0.05 | <0.05 | [39] |
S39221 | NMDA receptor NR1 | 2.5 | literature | <0.05 | <0.05 | [40] |
X57573 | GAD | 2.9 | literature | <0.05 | <0.05 | |
AI102205 | Vesicle associated calmodulin protein | 4.6 | Test confirmed | <0.05 | <0.05 | |
D17764 | Synuclein beta | 2.2 | Test confirmed | <0.05 | <0.05 | |
AF023087 | NGFI-A | 2.2 | Test confirmed | <0.05 | <0.05 | |
D12573 | Hippocalcin | 2.2 | Test confirmed | <0.05 | <0.05 | |
AI639118 | EST | 2.5 | Test confirmed | <0.05 | <0.05 | |
X54249 | Zinc finger protein | 2.4 | Test not confirmed | <0.05 | <0.05 | |
X67241 | Guanine nucleotide releasing factor | 2.2 | Not tested | <0.05 | <0.05 | |
L25633 | Neuroendocrine-specific protein | 2.0 | Not tested | <0.05 | <0.05 | |
D10666 | Neural visinin-like protein | 2.4 | Not tested | <0.05 | <0.05 | |
D90219 | CNP | 2.2 | Not tested | <0.05 | <0.05 | |
AF007758 | Synuclein-1 | 2.0 | Not tested | <0.05 | <0.05 | |
U88958 | Neuritin | 2.0 | Not tested | <0.05 | <0.05 | |
E13644 | Neurodap-1 | 2.0 | Not tested | <0.05 | <0.05 | |
AI639213 | EST | 3.1 | Not tested | <0.05 | <0.05 | |
AF041107 | Tulip2 | 2.1 | Not tested | >=0.05 | <0.05 | |
AF019974 | Chromogranin B | 2.5 | literature | <0.05 | >=0.05 | |
D10392 | Syntaxin 1A | 2.4 | literature | <0.05 | >=0.05 | [46] |
M93669 | Secretogranin | 2.4 | literature | <0.05 | >=0.05 | |
X62839 | K-channel 3.1 | 2.3 | literature | <0.05 | >=0.05 | [38] |
AA894330 | CAMKII beta | 2.2 | literature | <0.50 | >=0.05 | [31] |
L09119 | Neurogranin | 2.1 | literature | <0.05 | >=0.05 | [29] |
AA925248 | Sodium channel SCN6A | 10.0 | literature | <0.05 | >=0.05 | [48] |
AF078779 | 4-repeat ion channel | 6.9 | Test confirmed | <0.05 | >=0.05 | |
S80376 | G alpha(olf) | 2.6 | Test confirmed | <0.05 | >=0.05 | |
AI014091 | MRG1 | 2.1 | Not tested | <0.05 | >=0.05 | |
AI639036 | EST | 11.3 | Not tested | <0.05 | >=0.05 | |
AI639062 | EST | 2.9 | Not tested | <0.05 | >=0.05 | |
AI639470 | EST | 2.8 | Not tested | <0.05 | >=0.05 | |
M20722 | Proline rich protein | 2.7 | Not tested | <0.05 | >=0.05 | |
AF034899 | Olfactory receptor (SCR D-9) | 2.3 | Not tested | <0.05 | >=0.05 | |
AF019043 | Dynamin-like protein | 2.2 | Not tested | <0.05 | >=0.05 | |
AF091834 | NSF | 2.2 | Not tested | <0.05 | >=0.05 | |
X67877 | Resiniferatoxin-binding protein | 2.1 | Not tested | <0.05 | >=0.05 | |
AF089839 | N-ethylmaleimide sensitive factor | 2.1 | Not tested | <0.50 | >=0.05 | |
AI072943 | EST | 2.1 | Not tested | <0.05 | >=0.05 | |
AA866291 | EST | 2.0 | Not tested | <0.05 | >=0.05 |
Genes that are enriched in the dorsal spinal cord based on microarray analysis.
Description | Accession# | D vs V ratio | Description | Accession# | D vs V ratio |
---|---|---|---|---|---|
Neuropeptide | Calcium calmodulin binding protein | ||||
Somatostatin** | M25890 | 11.1–12.4 | Vesicle associated calmodulin protein | AI102205 | 4.60 |
Protachykinin | X56306 | 6.45 | Neurogranin ** | L09119 | 2.1–4.1 |
Beta-tachykinin | M15191 | 5.02 | Chromogranin B | AF019974 | 2.49 |
Proenkephalin | S49491 | 4.89 | Neural visinin-like protein | D10666 | 2.42 |
NPY | M15880 | 2.44 | Secretogranin | M93669 | 2.35 |
Neurokinin B | M16410 | 2.27 | Hippocalcin | D12573 | 2.16 |
Nociceptin | S79730 | 2.10 | |||
CNP | D90219 | 2.17 | Others | ||
Syntaxin 1A | D10392 | 2.43 | |||
Channel | Synuclein-1 | AF007758 | 2.03 | ||
Sodium channel SCN6A | AA925248 | 10.02 | Synuclein beta | D17764 | 2.21 |
Four repeat ion channel | AF078779 | 6.92 | Neuritin | U88958 | 2.03 |
NMDA receptor NR1 | S39221 | 2.48 | Neurodap-1 | E13644 | 2.03 |
K channel Kv 3.1** | X62840 | 2.2–2.3 | GAD | X57573 | 2.86 |
Proline-rich protein | M20722 | 2.73 | |||
Signaling | NSF | AF091834 | 2.16 | ||
Cannabinoid receptor | X55812 | 2.93 | Resiniferatoxin-binding protein | X67877 | 2.13 |
GABA-B R2 | AF058795 | 2.79 | N-ethylmaleimide sensitive factor | AF089839 | 2.08 |
Olfactory receptor (SCR D-9) | AF034899 | 2.35 | Tulip2 | AF041107 | 2.08 |
G alpha (olf) | S80376 | 2.63 | Neuroendocrine-specific protein | L25633 | 2.01 |
Guanine nucleotide releasing factor | X67241 | 2.21 | Dynamin-like protein | AF019043 | 2.22 |
CAMK I beta 2 | AB004267 | 2.73 | |||
CAMKII beta | AA894330 | 2.15 | EST | ||
PKC beta | X04139 | 2.29 | EST | AI639036 | 11.34 |
EST | AI639213 | 3.13 | |||
Transcription factor | EST | AI639062 | 2.88 | ||
Zinc finger protein | X54249 | 2.40 | EST | AI639470 | 2.77 |
NGFI-A | AF023087 | 2.21 | EST | AI639118 | 2.50 |
MRG1 | AI014091 | 2.12 | EST | AI072943 | 2.06 |
EST | AA866291 | 2.01 |
QRT-PCR confirmation of genes enriched in the dorsal spinal cord
Differential expression of genes in the dorsal versus ventral spinal cord as revealed by QRT-PCR. The ratio of expression between dorsal and ventral spinal cord for each gene in each dorsal and ventral spinal cord sample pair is shown. Data were from QRT-PCR assays performed in triplicate for a pair of RNA samples, each of which was pooled from the dorsal or ventral samples of the 3 pairs of RNA samples used for microarray analysis (from a total of 9 animals). The length of bars represent 95% confidence intervals and the symbol on each bar is the mean of ratios estimated from the assay performed in triplicate.
We confirmed the enriched expression of the following genes: a transcription factor NGFI-A, a putative four repeat ion channel, a vesicle associated calcium/calmodulin binding protein that is homologous to CAMK IV, a neuronal calcium sensor protein hippocalcin, synuclein beta, and an EST gene. The Zinc finger protein mRNA was found to be only marginally enriched in the dorsal spinal cord (Fig. 1).
Cellular expression of dorsal spinal cord-enriched genes
mRNA localization of neurogranin and CAMK IV homolog. Neurogranin (A) and CAMK IV homolog (B) are located in the superficial dorsal horn and exhibit different patterns with the antisense riboprobes. Pictures were pieced together from 4 images which were taken using 4X objectives.
Cellular localization in the spinal cord as revealed by immunohistochemistry. Galpha(olf) (A), Syntaxin 1A (B), and PKCγ (C) are localized primarily in the dorsal spinal cord. Images were taken from sections of spinal cord from the same animal although similar patterns of staining were found when two animals were examined.
Regulation of dorsally enriched genes in a chronic neuropathic pain model
Relative gene expression in the spinal cord of SNL (Chung) neuropathic pain model as revealed by QRT-PCR.
Chung Ipsilateral vs Contralateral | Chung Ipsilateral vs Sham ipsilateral | |||||
---|---|---|---|---|---|---|
Relative Expression Scale | Relative Expression Scale | |||||
Estimate | Lower 95% CI | Upper 95% CI | Estimate | Lower 95% CI | Upper 95% CI | |
NGFI-A | 1.211 | 0.887 | 1.654 | 1.217 | 0.959 | 1.544 |
4 Repeat Ion Channel | 0.837 | 0.613 | 1.143 | 1.197 | 0.944 | 1.519 |
CAMK IV Homolog | 0.968 | 0.709 | 1.322 | 1.206 | 0.950 | 1.530 |
EST (AI639118) | 0.831 | 0.609 | 1.135 | 0.859 | 0.677 | 1.089 |
Hippocalcin | 1.089 | 0.798 | 1.487 | 1.237 | 0.975 | 1.569 |
Synuclein beta | 1.079 | 0.791 | 1.473 | 1.278 | 1.007 | 1.621 |
Neurogranin | 0.897 | 0.501 | 1.606 | 0.977 | 0.562 | 1.698 |
Discussion
The dorsal spinal cord is a region implicated in sensory perception, receiving, transmitting, and modulation of signals from peripheral sensory system. It is important in the integration of computational and neuromodulatory functions. In a pathological state, the changes in the dorsal horn of the spinal cord may contribute to prolonged abnormal pain. The aim of this study was to find genes that are enriched in the dorsal spinal cord that can potentially play important roles in pain transmission, pain modulation, and pathophysiological conditions. Since microarray technology represents a potentially powerful method for identifying cell type- and regionally restricted genes expressed in the nervous system [7, 8], we conducted a large-scale screening using this technique for genes that are expressed higher in the dorsal spinal cord. Genes found in this screen can then be further studied for their cellular localization in the spinal cord.
Validation of microarray data
The reliability of these DNA microarray results is demonstrated by the following three observations: (1) A subset of the genes was observed to be consistently regulated by multiple probesets on the microarray; (2) We detected 21 genes (by 23 probesets) which have previously been described to be enriched in the dorsal spinal cord; (3) Genes that we chose to study further were confirmed to be expressed higher in the dorsal spinal cord by QRT-PCR (6 out of 7), in situ hybridization (2 out of 2), and immunohistochemistry (2 out of 2). Based on the consistency and the rate of independent confirmation, many of the genes listed in the tables are likely to be true positives.
We note that our list of dorsal spinal cord-enriched genes is likely to be incomplete since the Affymetrx DNA microarrays do not represent the entire rat genome and our study may not have been sensitive enough to discover all the genes, especially those that are expressed at low levels.
Toward a molecular anatomy of the spinal cord, particularly in the pain sensory pathways
We found that some genes are expressed in a lamina-specific manner, while others may have a gradient of expression. Neurogranin is highly enriched in the superficial laminae. PKCγ has been demonstrated to be expressed in lamina IIi. The colocalization of neurogranin and PKCγ in similar regions in the spinal cord suggests that neurogranin may be an endogenous substrate of PKCγ in the spinal cord. Neurogranin has been shown to be phosphorylated by PKCγ, and this phosphorylation is greatly decreased in PKCγ knockout mice, suggesting neurogranin is a PKCγ-specific substrate [9]. Evidence that strongly suggests the phosphorylation of neurogranin plays an important role in neural plasticity comes from the studies that demonstrated neurogranin knockout mice show essentially the same deficits in behaviors related to learning and memory as that of the PKCγ knockout mice [10]. Neurogranin is not only a substrate of PKCγ, but also plays a important role in regulating PKC signaling [11]. Interstingly, PKCγ knockout mice demonstrate reduced neuropathic pain [12]. Similar to neurogranin, we found that a calmodulin-binding, vesicle-associated, CAM kinase IV-like protein is highly expressed and enriched in the superficial layer of the dorsal spinal cord. The function of this gene is not yet known. However, the protein was also found to be enriched in forebrain neurites [13].
Using immunostaining, we found that Syntaxin 1A and Galpha(olf) proteins were enriched in the dorsal spinal cord. Syntaxin 1A has previously been shown to be preferentially expressed in the dorsal spinal cord neuropil. Galpha(olf) is a G protein that was initially found to be expressed in the olfactory epithelium. The Galpha(olf) has been shown to be specifically expressed in the striatum in the brain and was found to colocalize with and activated by adenosine A2A receptors [14]. It is possible that the specific expression of Galpha(olf) in the dorsal spinal cord implies its mediation of functions for specific G-protein-coupled receptors in these neurons.
Conclusions
1. We conducted a large-scale screening using DNA microarray for genes that are specifically expressed in the dorsal spinal cord. We found additional neuropeptides, receptors, ion channels, and signaling molecules to be enriched in the dorsal spinal cord.
2. The regulation of a subset of the genes was confirmed by QRT-PCR. Six out of the seven genes were confirmed to be enriched in the dorsal spinal cord.
3. In situ hybridization and immunohistochemistry revealed that neurogranin, CAMK IV homolog, Galpha(olf), and Syntaxin 1A, are indeed enriched in the dorsal spinal cord.
4. Through the detection of a large number of genes which were previously determined to have enriched expression in the dorsal spinal cord and our QRT-PCR, in situ hybridization and immunohistochemical confirmations, this study provides a level of validation for the case of Affymetrix DNA microarrays in conjunction with SAFER algorithm to detect differences in gene regulation.
Materials and Methods
Animals
Male Sprague-Dawley rats (Taconic, Germantown, NY.) weighing 200–300 g at the time of testing, were maintained in a climate-controlled room on a 12 h light/dark cycle (lights on at 06:00) with food and water available ad libitum. All of the handling of the animals and testing was performed in accordance with the policies and recommendations of the International Association for the Study of Pain [15] and received approval from the Institutional Animal Care and Use Committee of MRL, West Point, PA.
Spinal nerve ligation (SNL) injury was induced using the procedure of Kim and Chung [16]. Anesthesia was induced with 2% gaseous isofluorane (For induction 3–5% and O2 500–700 μl, for maintenance 2–3% and O2 400–500 μl). Following dorsal skin incision and muscle separation, the posterior interarticular transverse process of L/S1 was exposed and carefully removed with a micro Rongeur. The L5 and L6 spinal nerves were tightly ligated by a square knot with 6–0 silk thread. The muscles were closed with 4–0 absorbable sutures and the skin was closed with wound clips. Rats that exhibited motor deficiency (such as paw dragging) or failure to exhibit subsequent tactile allodynia were excluded from further testing (less than 5% of the animals were excluded). Sham control rats underwent the same operation and handling as the experimental animals but without spinal nerve ligation.
Behavioral testing
The assessment of tactile allodynia (i.e. decreased threshold to paw withdrawal following probing with non-noxious mechanical stimuli) consisted of measuring the withdrawal threshold of the paw ipsilateral to the site of nerve injury in response to probing with a series of calibrated von Frey filaments. Each filament was applied perpendicularly to the plantar surface of the ligated paw of rats kept in suspended wire-mesh cages. The withdrawal threshold was determined by sequentially increasing and decreasing the stimulus strength ("up-down" method), analyzed with a Dixon non-parametric test [17] and expressed as the mean withdrawal threshold. Animals were tested before surgery and only animals with a paw withdrawal threshold greater than 10 grams were used for the subsequent study. Surgically treated animals were then tested on postoperative days 3 and 12. Only those animals that showed allodynia (paw withdrawal threshold smaller than 3 g) on both days were used for tissue collection on postoperative day 13 (less then 10% of the animals were excluded for tissue collection).
Tissue dissection and RNA preparation
Total RNA from each sample was prepared using Trizol™ (Life Technologies, Gaithersburg, MD), followed by RNEasy™ (Qiagen, Hilden Germany). RNA samples were analyzed by denatured gel electrophoresis. In addition, total RNA quality was assessed by capillary electrophoresis (Bioanalyzer 2100 Agilent, Palo Alto, CA) to ensure that the 28S:18S rRNA ratio was >1.0 for each sample.
Affymetrix microarray hybridization and staining
Hybridization probes were prepared according to Affymetrix instruction [18]. 5 μM primer encoding the T7 RNA polymerase promoter linked to oligo-dT24 primer was used to prime double-stranded cDNA synthesis from each total RNA sample (25 μg). cDNA synthesis reactions were carried out at 42°C using Superscript II RNAseH- reverse transcriptase (Life Technologies, Rockville MD). Second strand cDNA synthesis was finished using DNA polymerase I and T4 DNA ligase. Each double-stranded cDNA sample was purified by sequential phenol/chloroform extraction (Ambion, Austin, TX) and adsorption to silica (Qiaquick™ kit, Qiagen, Hilden, Germany) according to manufacturers' instructions. Half of each cDNA sample was transcribed in vitro into the copy RNA (cRNA) labeled with biotin-UTP and biotin-CTP using the BioArray High Yield RNA Transcript Labeling Kit (Enzo Biochemicals, New York, NY). These cRNA transcripts were purified using RNeasy™ columns (Qiagen, Hilden Germany) and quantitated by measuring absorption at 260 nm/280 nm. 15 μg aliquots of each cRNA sample were fragmented at 95°C for 35 min in 40 mM Tris-acetate, pH8.0, 100 mM KOAc, and 30 mM MgOAc to a mean size of ~50–150 nucleotides. Hybridization buffer (0.1 M MES, pH6.7, 1 M NaCl, 0.01% Triton, 0.5 mg/ml BSA, 0.1 mg/ml H. Sperm DNA, 50 pM Control Oligo B2, and 1X Eukaryotic hybridization Control) was added to each sample. Samples were then hybridized to RG-U34A microarrays (Affymetrix) at 45°C for 16 h. Microarrays were washed and sequentially incubated with streptavidin phycoerythrin (Molecular Probes, Eugene, OR), biotinylated anti-streptavidin antibody (Vector Laboratories, Inc., Burlingame, CA), and streptavidin phycoerythrin on the Fluidic Station (Affymetrix, Santa Clara, CA). Finally, the microarrays were scanned with a dedicated Gene Array Scanner (Hewlett Packard Instruments, TX) to capture a fluorescence image.
Affymetrix microarray data analysis
A total of 9 animals was divided into 3 groups, and the dorsal and ventral spinal cord were pooled for each group to give rise to 6 samples. Each sample was analyzed on one Affymetrix microarray RG-U34A. For each probeset (an array of 16 pairs of oligonucleotides for a specific gene) an index of gene expression was calculated and analyzed using the SAFER algorithm [19] for all chip analysis. The SAFER gene expression index is a robust and resistant measure of gene expression which is an alternative to the 'average difference' calculated by the Affymetrix analysis software and the model-based expression index proposed by Li and Wong [20]. Like Li and Wong's procedure, the procedure for calculating the SAFER gene index involves both between-array normalization and an adjustment for probe-specific biases.
To analyze gene expression in the spinal cord, differences in mean level of the gene expression index between dorsal and ventral samples were assessed for each probeset using a paired t-test and ANOVA. These models facilitated estimation of ratios comparing the dorsal and ventral samples and calculation of p-values testing whether the ratios are different from one (i.e. a ratio of one implies no change between the means for the experimental conditions). By fitting separate models for each probeset, differences were assessed using an error term that included biological variability between samples and did not assume that this variability was the same for all genes.
Quantitative Real-Time PCR (QRT-PCR)
Total RNA was treated with DNase I, Amplification Grade (Invitrogen, Carlsbad, CA) to remove DNA contamination before cDNA synthesis. cDNA was synthesized with oligo (dT)12–18 using Superscript First-Strand Synthesis System for RT-PCR (Invitrogen, Carlsbad, CA). Real-time PCR analysis was performed on a Applied Biosystems ABI Prism7700 Sequence Detection System. Matching primers and fluorescence probes were designed for each of the genes using the Primer Express program provided by Applied Biosystems. Both forward and reverse primers were used at 900 nM. In all cases, the final probe concentration was 250 nM. The PCR reaction was performed in a final volume of 50 μl using TaqMan Universal PCR Master Mix containing AmpliTaq GoldR DNA Polymerase, AmpEraseR UNG, dNTPs (with dUTP), Passive Reference 1, optimized buffer components (proprietary formulation) and 1 μl of cDNA template.
Primers and probes used for QRT-PCR. The sequences of forward, reverse and specific probes are listed sequentially for each gene (accession #).
Gene (GenBank accession #) | Bases | Sequence (5'-3') | Product size (bp) |
---|---|---|---|
NGFI-A (AF023087) | 120–140 | TATCCATGTTCGGGAGTTGGA | 81 |
171–200 | AATGAACTTCATGTTCATAGCATACAAAGT | ||
142–170 | CACCGCCTACTCAGTAGGTAACCACAGCA | ||
Four Repeat Ion Channel (AF078779) | 5127–5150 | GGAGGAAGGACAACAATGAAGTCT | 75 |
5183–5201 | TTCGGAGCCACAGGAAGCT | ||
5155–5177 | TGTGCAAGATGAACCCCATGCCA | ||
CAMK IV homolog (AI102205) | 263–283 | TGTGAAAAGCAAGCTCCCAAA | 81 |
323–343 | CAGGCTCAGGCCATAAATCCT | ||
299–319 | CTGCCATGCCTCCCTGGGAGG | ||
EST (AI639118) | 56–80 | GAAGTTGCTCTGACTGAATGGATTT | 123 |
153–178 | TCACAGACTTACATCCTGTTTCTGAA | ||
93–121 | AGCTGTCACACTTGTTGTCGGAAGCACAC | ||
Hippocalcin (D12573) | 607–628 | CCGGAAAAGAGGACTGAGAAAA | 134 |
723–740 | CTGCTGGGATCGCATTGC | ||
630–656 | CTTCCGCCAAATGGACACAAACAATGA | ||
Synuclein beta (D17764) | 227–247 | AACAAAGGAGCAGGCATCTCA | 127 |
336–353 | TTGGGCCACTTCCTCTGG | ||
274–296 | CTGGGAACATTGCAGCAGCCACC | ||
Zinc Finger Protein (X54249) | 1870–1893 | GAGAGTGCACACATCAGCATTAGA | 98 |
1944–1967 | TCCTTTTCACCATCGTGTAAGTCA | ||
1918–1941 | CAGCTCTGTACCTCAGCCGCCCAC |
QRT-PCR Data Analysis
Average Ct values from triplicate PCR reactions were normalized to average Ct values for GAPDH RNA from the same cDNA preparations. The ratio of expression of each gene between dorsal and ventral samples was calculated as: 2-(meanΔΔCt). C t represents the threshold cycle and ΔΔC t represents the difference Ct(test gene) - Ct(GAPDH RNA) for dorsal sample minus ventral sample. Using the ANOVA method, 95% confidence intervals were determined for each ratio as:
where t0.975 is the 97.5th percentile of the t-distribution with N-m degrees of freedom, N is the total pooled sample size for a gene, m is the number of treatments including control, s is the pooled standard deviation, n i and n j are the number of dorsal and ventral samples, respectively, being compared. Similarly, expression between ipsilateral and contralateral samples were analyzed.
Immunocytochemistry
Rat spinal cords were dissected from rats which had been perfused with 4% paraformaldehyde and post fixed for 4 hours. After cryoprotection in 30% sucrose overnight and 30% sucrose/OCT (1:1) mixture for 8 hours, the tissue was frozen and sections of 30 um were cut with cryostat. Tissue sections were floated, washed several times with PBS, then treated with 0.5% H2O2 for 30 minutes followed by washing with PBS 3 times. The sections were then incubated with blocking buffer (3% BSA + 3% donkey serum + 0.1% Triton) for 1 hour, followed by incubation with primary antibodies for 2 hours at room temperature. After washing with PBS 10 times, the sections were incubated with secondary antibodies, AB enzyme reagent (ABC kit, Vector) and developed using a Vector DAB staining Kit according to manufacturer's recommendations. The antibody to syntaxin-1 and Galpha(olf) were purchased from Santa Cruz Biotechnology, Inc. and used at 1: 20 dilution.
In situhybridization
Twenty micron sections were collected on gelatin-coated slides, dried and then stored at -80°C in desiccated boxes. At the time of processing, the slides were warmed to room temperature, postfixed in paraformaldehyde, treated with acetic anhydride and then delipidated and dehydrated. Processed section-mounted slides were hybridized with antisense or sense (control) riboprobes (8–12 × 106 DPM/slide) in 50% formamide hybridization mix and incubated overnight at 55°C in an open-air humidified slide chamber. In the morning, the slides were immersed in 2 × SSC (0.3 M NaCl, 0.03 M sodium citrate; pH 7.0)/10 mM DTT, treated with RNase A (20 mg/ml) and washed 2 × 30 min at 65°C in 0.1× SSC to remove nonspecific label. After dehydration, the slides were apposed to BioMax (BMR-1; Kodak) X-ray film for 1–2 days and then dipped in NTB2 nuclear emulsion (Eastman Kodak; diluted 1:1 with 600 mM ammonium acetate). The slides were exposed for 21 days in light-tight black desiccated boxes, photographically processed, stained in Cresyl violet and coversliped.
Declarations
Acknowledgements
The authors thank Paul Shughrue, Amy Hughes, Betty Ky, Ken Lodge, Carol Burns, Susan Hill, and Stacy Pratt for their technical advice and skillful technical assistance.
Authors’ Affiliations
References
- Kandel ER, Schwartz JH, Jessell TM: Principles of Neural science. 2000, New York: McGraw-Hill, 4Google Scholar
- Molander C, Grant G: Spinal cord cytoarchitecture. In: The rat nervous system. Edited by: Paxinos G. 1995, San Diego: Academic Press, 39-45. 2Google Scholar
- Ribeiro-Silva A: Substantia Gelatinosa of spinal cord. In: The rat nervous system. Edited by: Paxinos G. 1995, San Diego: Academic Press, 47-59. 2Google Scholar
- Doubell TP, Mannion RJ, Woolf CJ: The dorsal horn: State-dependent sensory processing, plasticity and the generation of pain. In: The textbook of Pain. Edited by: Wall PD, Melzack D. 1999, London: Churchill Livingstone, 165-182. 4Google Scholar
- Field HL, Basbaum AI: Central nervous system mechanisms of pain modulation. In: The Textbook of Pain. Edited by: Wall PD, Melzeck R. 1999, London: Churchill Livingstone, 309-329. 4Google Scholar
- Mori M, Kose A, Tsujino T, Tanaka C: Immunocytochemical localization of protein kinase C subspecies in the rat spinal cord: light and electron microscopic study. J Comp Neurol. 1990, 299: 167-77.View ArticlePubMedGoogle Scholar
- Zirlinger M, Kreiman G, Anderson DJ: Amygdala-enriched genes identified by microarray technology are restricted to specific amygdaloid subnuclei. Proc Natl Acad Sci U S A. 2001, 98: 5270-5. 10.1073/pnas.091094698.PubMed CentralView ArticlePubMedGoogle Scholar
- Sandberg R, Yasuda R, Pankratz DG, Carter TA, Del Rio JA, Wodicka L, Mayford M, Lockhart DJ, Barlow C: Regional and strain-specific gene expression mapping in the adult mouse brain. Proc Natl Acad Sci U S A. 2000, 97: 11038-43. 10.1073/pnas.97.20.11038.PubMed CentralView ArticlePubMedGoogle Scholar
- Ramakers GM, Gerendasy DD, de Graan PN: Substrate phosphorylation in the protein kinase Cgamma knockout mouse. J Biol Chem. 1999, 274: 1873-4. 10.1074/jbc.274.4.1873.View ArticlePubMedGoogle Scholar
- Pak JH, Huang FL, Li J, Balschun D, Reymann KG, Chiang C, Westphal H, Huang KP: Involvement of neurogranin in the modulation of calcium/calmodulin-dependent protein kinase II, synaptic plasticity, and spatial learning: a study with knockout mice. Proc Natl Acad Sci U S A. 2000, 97: 11232-7. 10.1073/pnas.210184697.PubMed CentralView ArticlePubMedGoogle Scholar
- Chakravarthy B, Morley P, Whitfield J: Ca2+-calmodulin and protein kinase Cs: a hypothetical synthesis of their conflicting convergences on shared substrate domains. Trends Neurosci. 1999, 22: 12-6. 10.1016/S0166-2236(98)01288-0.View ArticlePubMedGoogle Scholar
- Malmberg AB, Chen C, Tonegawa S, Basbaum AI: Preserved acute pain and reduced neuropathic pain in mice lacking PKCgamma. Science. 1997, 278: 279-83. 10.1126/science.278.5336.279.View ArticlePubMedGoogle Scholar
- Godbout M, Erlander MG, Hasel KW, Danielson PE, Wong KK, Battenberg EL, Foye PE, Bloom FE, Sutcliffe JG: 1G5: a calmodulin-binding, vesicle-associated, protein kinase-like protein enriched in forebrain neurites. J Neurosci. 1994, 14: 1-13.PubMedGoogle Scholar
- Kull B, Svenningsson P, Fredholm BB: Adenosine A(2A) receptors are colocalized with and activate g(olf) in rat striatum. Mol Pharmacol. 2000, 58: 771-7.PubMedGoogle Scholar
- Zimmermann M: Ethical guidelines for investigations of experimental pain in conscious animals. Pain. 1983, 16: 109-110. 10.1016/0304-3959(83)90201-4.View ArticlePubMedGoogle Scholar
- Kim SH, Chung JM: An experimental model for peripheral neuropathy produced by segmental spinal nerve ligation in the rat. Pain. 1992, 50: 355-63. 10.1016/0304-3959(92)90041-9.View ArticlePubMedGoogle Scholar
- Chaplan SR, Bach FW, Pogrel JW, Chung JM, Yaksh TL: Quantitative assessment of tactile allodynia in the rat paw. J Neurosci Methods. 1994, 53: 55-63. 10.1016/0165-0270(94)90144-9.View ArticlePubMedGoogle Scholar
- Lockhart DJ, Dong H, Byrne MC, Follettie MT, Gallo MV, Chee MS, Mittmann M, Wang C, Kobayashi M, Horton H, Brown EL: Expression monitoring by hybridization to high-density oligonucleotide arrays. Nat Biotechnol. 1996, 14: 1675-80.View ArticlePubMedGoogle Scholar
- Holder D, Pikounis V, Raubertas R, Svetnik V, Soper K: Statistical Analysis of High Density Oligonucleotide Arrays: A SAFER Approach. In: Proceedings of the American Statistical Association. Atlanta, Georgia. 2002Google Scholar
- Li C, Wong WH: Model-based analysis of oligonucleotide arrays: expression index computation and outlier detection. Proc Natl Acad Sci U S A. 2001, 98: 31-6. 10.1073/pnas.011404098.PubMed CentralView ArticlePubMedGoogle Scholar
- Kiyama H, Emson PC: Distribution of somatostatin mRNA in the rat nervous system as visualized by a novel non-radioactive in situ hybridization histochemistry procedure. Neuroscience. 1990, 38: 223-44. 10.1016/0306-4522(90)90388-K.View ArticlePubMedGoogle Scholar
- Kuraishi Y, Hirota N, Sato Y, Hino Y, Satoh M, Takagi H: Evidence that substance P and somatostatin transmit separate information related to pain in the spinal dorsal horn. Brain Res. 1985, 325: 294-8. 10.1016/0006-8993(85)90326-9.View ArticlePubMedGoogle Scholar
- Yin KJ: Distribution of somatostatin mRNA containing neurons in the primary pain relaying nuclei of the rat. Anat Rec. 1995, 241: 579-84.View ArticlePubMedGoogle Scholar
- Lindefors N, Brene S, Herrera-Marschitz M, Persson H: Regulation of neuropeptide Y gene expression in rat brain. Ann N Y Acad Sci. 1990, 611: 175-85.PubMedGoogle Scholar
- Merchenthaler I, Maderdrut JL, Altschuler RA, Petrusz P: Immunocytochemical localization of proenkephalin-derived peptides in the central nervous system of the rat. Neuroscience. 1986, 17: 325-48. 10.1016/0306-4522(86)90250-2.View ArticlePubMedGoogle Scholar
- Sweetnam PM, Wrathall JR, Neale JH: Localization of dynorphin gene product-immunoreactivity in neurons from spinal cord and dorsal root ganglia. Neuroscience. 1986, 18: 947-55. 10.1016/0306-4522(86)90110-7.View ArticlePubMedGoogle Scholar
- Zhang F, Van Bree L, Albala N, Verslype M, Vanderhaeghen JJ: NMDA receptor antagonist MK-801 down-regulates rat striatal proenkephalin and protachykinin mRNAs. Neurochem Int. 1996, 28: 189-92. 10.1016/0197-0186(95)00070-4.View ArticlePubMedGoogle Scholar
- Pohl M, Ballet S, Collin E, Mauborgne A, Bourgoin S, Benoliel JJ, Hamon M, Cesselin F: Enkephalinergic and dynorphinergic neurons in the spinal cord and dorsal root ganglia of the polyarthritic rat – in vivo release and cDNA hybridization studies. Brain Res. 1997, 749: 18-28. 10.1016/S0006-8993(96)01161-4.View ArticlePubMedGoogle Scholar
- Houben MP, Lankhorst AJ, van Dalen JJ, Veldman H, Joosten EA, Hamers FP, Gispen WH, Schrama LH: Pre- and postsynaptic localization of RC3/neurogranin in the adult rat spinal cord: an immunohistochemical study. J Neurosci Res. 2000, 59: 750-9. 10.1002/(SICI)1097-4547(20000315)59:6<750::AID-JNR7>3.0.CO;2-B.View ArticlePubMedGoogle Scholar
- Calver AR, Medhurst AD, Robbins MJ, Charles KJ, Evans ML, Harrison DC, Stammers M, Hughes SA, Hervieu G, Couve A, Moss SJ, Middlemiss DN, Pangalos MN: The expression of GABA(B1) and GABA(B2) receptor subunits in the cNS differs from that in peripheral tissues. Neuroscience. 2000, 100: 155-70. 10.1016/S0306-4522(00)00262-1.View ArticlePubMedGoogle Scholar
- Rina S, Jusuf AA, Sakagami H, Kikkawa S, Kondo H, Minami Y, Terashima T: Distribution of Ca(2+)/calmodulin-dependent protein kinase I beta 2 in the central nervous system of the rat. Brain Res. 2001, 911: 1-11. 10.1016/S0006-8993(01)02440-4.View ArticleGoogle Scholar
- Rowan S, Todd AJ, Spike RC: Evidence that neuropeptide Y is present in GABAergic neurons in the superficial dorsal horn of the rat spinal cord. Neuroscience. 1993, 53: 537-45. 10.1016/0306-4522(93)90218-5.View ArticlePubMedGoogle Scholar
- Igwe OJ, Chronwall BM: Hyperalgesia induced by peripheral inflammation is mediated by protein kinase C betaII isozyme in the rat spinal cord. Neuroscience. 2001, 104: 875-90. 10.1016/S0306-4522(01)00107-5.View ArticlePubMedGoogle Scholar
- Akinori M: Subspecies of protein kinase C in the rat spinal cord. Prog Neurobiol. 1998, 54: 499-530. 10.1016/S0301-0082(97)00077-4.View ArticlePubMedGoogle Scholar
- Lucas LR, Hurley DL, Krause JE, Harlan RE: Localization of the tachykinin neurokinin B precursor peptide in rat brain by immunocytochemistry and in situ hybridization. Neuroscience. 1992, 51: 317-45. 10.1016/0306-4522(92)90318-V.View ArticlePubMedGoogle Scholar
- Farquhar-Smith WP, Egertova M, Bradbury EJ, McMahon SB, Rice AS, Elphick MR: Cannabinoid CB(1) receptor expression in rat spinal cord. Mol Cell Neurosci. 2000, 15: 510-21. 10.1006/mcne.2000.0844.View ArticlePubMedGoogle Scholar
- Merchenthaler I, Maderdrut JL, O'Harte F, Conlon JM: Localization of neurokinin B in the central nervous system of the rat. Peptides. 1992, 13: 815-29. 10.1016/0196-9781(92)90192-6.View ArticlePubMedGoogle Scholar
- Weiser M, Vega-Saenz de Miera E, Kentros C, Moreno H, Franzen L, Hillman D, Baker H, Rudy B: Differential expression of Shaw-related K+ channels in the rat central nervous system. J Neurosci. 1994, 14: 949-72.PubMedGoogle Scholar
- Lai CC, Wu SY, Dun SL, Dun NJ: Nociceptin-like immunoreactivity in the rat dorsal horn and inhibition of substantia gelatinosa neurons. Neuroscience. 1997, 81: 887-91. 10.1016/S0306-4522(97)00251-0.View ArticlePubMedGoogle Scholar
- Tolle TR, Berthele A, Laurie DJ, Seeburg PH, Zieglgansberger W: Cellular and subcellular distribution of NMDAR1 splice variant mRNA in the rat lumbar spinal cord. Eur J Neurosci. 1995, 7: 1235-44.View ArticlePubMedGoogle Scholar
- Tillakaratne NJ, Mouria M, Ziv NB, Roy RR, Edgerton VR, Tobin AJ: Increased expression of glutamate decarboxylase (GAD(67)) in feline lumbar spinal cord after complete thoracic spinal cord transection. J Neurosci Res. 2000, 60: 219-30. 10.1002/(SICI)1097-4547(20000415)60:2<219::AID-JNR11>3.3.CO;2-6.View ArticlePubMedGoogle Scholar
- Liang F, Jones EG: Peripheral nerve stimulation increases Fos immunoreactivity without affecting type II Ca2+/calmodulin-dependent protein kinase, glutamic acid decarboxylase, or GABAA receptor gene expression in cat spinal cord. Exp Brain Res. 1996, 111: 326-36.View ArticlePubMedGoogle Scholar
- Feldblum S, Dumoulin A, Anoal M, Sandillon F, Privat A: Comparative distribution of GAD65 and GAD67 mRNAs and proteins in the rat spinal cord supports a differential regulation of these two glutamate decarboxylases in vivo. J Neurosci Res. 1995, 42: 742-57.View ArticlePubMedGoogle Scholar
- Kato A, Kammen-Jolly K, Fischer-Colbie R, Humpel C, Schrott-Fischer A, Marksteiner J: Co-distribution patterns of chromogranin B-like immunoreactivity with chromogranin A and secretoneurin within the human brainstem. Brain Res. 2000, 852: 444-52. 10.1016/S0006-8993(99)02229-5.View ArticlePubMedGoogle Scholar
- Kroesen S, Marksteiner J, Leitner B, Hogue-Angeletti R, Fischer-Colbrie R, Winkler H: Rat brain: distribution of immunoreactivity of PE-11, a peptide derived from chromogranin B. Eur J Neurosci. 1996, 8: 2679-89.View ArticlePubMedGoogle Scholar
- Aguado F, Majo G, Ruiz-Montasell B, Llorens J, Marsal J, Blasi J: Syntaxin 1A and 1B display distinct distribution patterns in the rat peripheral nervous system. Neuroscience. 1999, 88: 437-46. 10.1016/S0306-4522(98)00247-4.View ArticlePubMedGoogle Scholar
- Marksteiner J, Kirchmair R, Mahata SK, Mahata M, Fischer-Colbrie R, Hogue-Angeletti R, Saria A, Winkler H: Distribution of secretoneurin, a peptide derived from secretogranin II, in rat brain: an immunocytochemical and radioimmunological study. Neuroscience. 1993, 54: 923-44. 10.1016/0306-4522(93)90585-4.View ArticlePubMedGoogle Scholar
- Tzoumaka E, Tischler AC, Sangameswaran L, Eglen RM, Hunter JC, Novakovic SD: Differential distribution of the tetrodotoxin-sensitive rPN4/NaCh6/Scn8a sodium channel in the nervous system. J Neurosci Res. 2000, 60: 37-44.View ArticlePubMedGoogle Scholar
Copyright
This article is published under license to BioMed Central Ltd. This is an Open Access article: verbatim copying and redistribution of this article are permitted in all media for any purpose, provided this notice is preserved along with the article's original URL.