Skip to main content

Table 4 Primers and probes used for QRT-PCR. The sequences of forward, reverse and specific probes are listed sequentially for each gene (accession #).

From: Dorsal horn-enriched genes identified by DNA microarray, in situ hybridization and immunohistochemistry

Gene (GenBank accession #) Bases Sequence (5'-3') Product size (bp)
NGFI-A (AF023087) 120–140 TATCCATGTTCGGGAGTTGGA 81
  171–200 AATGAACTTCATGTTCATAGCATACAAAGT  
  142–170 CACCGCCTACTCAGTAGGTAACCACAGCA  
Four Repeat Ion Channel (AF078779) 5127–5150 GGAGGAAGGACAACAATGAAGTCT 75
  5183–5201 TTCGGAGCCACAGGAAGCT  
  5155–5177 TGTGCAAGATGAACCCCATGCCA  
CAMK IV homolog (AI102205) 263–283 TGTGAAAAGCAAGCTCCCAAA 81
  323–343 CAGGCTCAGGCCATAAATCCT  
  299–319 CTGCCATGCCTCCCTGGGAGG  
EST (AI639118) 56–80 GAAGTTGCTCTGACTGAATGGATTT 123
  153–178 TCACAGACTTACATCCTGTTTCTGAA  
  93–121 AGCTGTCACACTTGTTGTCGGAAGCACAC  
Hippocalcin (D12573) 607–628 CCGGAAAAGAGGACTGAGAAAA 134
  723–740 CTGCTGGGATCGCATTGC  
  630–656 CTTCCGCCAAATGGACACAAACAATGA  
Synuclein beta (D17764) 227–247 AACAAAGGAGCAGGCATCTCA 127
  336–353 TTGGGCCACTTCCTCTGG  
  274–296 CTGGGAACATTGCAGCAGCCACC  
Zinc Finger Protein (X54249) 1870–1893 GAGAGTGCACACATCAGCATTAGA 98
  1944–1967 TCCTTTTCACCATCGTGTAAGTCA  
  1918–1941 CAGCTCTGTACCTCAGCCGCCCAC