Open Access

Cognitive dysfunction in NFI knock-out mice may result from altered vesicular trafficking of APP/DRD3 complex

  • Elizabeth A Donarum1,
  • Rebecca F Halperin2,
  • Dietrich A Stephan2 and
  • Vinodh Narayanan1Email author
BMC Neuroscience20067:22

https://doi.org/10.1186/1471-2202-7-22

Received: 03 November 2005

Accepted: 08 March 2006

Published: 08 March 2006

Abstract

Background

It has been estimated that more than 50% of patients with Neurofibromatosis type 1 (NF1) have neurobehavioral impairments which include attention deficit/hyperactivity disorder, visual/spatial learning disabilities, and a myriad of other cognitive developmental problems. The biological mechanisms by which NF1 gene mutations lead to such cognitive deficits are not well understood, although excessive Ras signaling and increased GABA mediated inhibition have been implicated. It is proposed that the cognitive deficits in NF1 are the result of dysfunctional cellular trafficking and localization of molecules downstream of the primary gene defect.

Results

To elucidate genes involved in the pathogenic process, gene expression analysis was performed comparing the expression profiles in various brain regions for control and Nf1+/- heterozygous mice. Gene expression analysis was performed for hippocampal samples dissected from postnatal day 10, 15, and 20 mice utilizing the Affymetrix Mouse Genome chip (Murine 430 2.0). Analysis of expression profiles between Nf1+/-and wild-type animals was focused on the hippocampus because of previous studies demonstrating alterations in hippocampal LTP in the Nf1+/- mice, and the region's importance in visual/spatial learning. Network analysis identified links between neurofibromin and kinesin genes, which were down regulated in the Nf1+/- mice at postnatal days 15 and 20.

Conclusion

Through this analysis, it is proposed that neurofibromin forms a binding complex with amyloid precursor protein (APP) and through filamin proteins interacts with a dopamine receptor (Drd3). Though the effects of these interactions are not yet known, this information may provide novel ideas about the pathogenesis of cognitive defects in NF1 and may facilitate the development of novel targeted therapeutic interventions.

Background

Neurofibromatosis type 1 (also known as von Recklinghausen disease) is an autosomal dominant disorder with a prevalence of 1 in 3500, and is characterized by hyperpigmented skin macules (café au lait spots), iris tumors (Lisch nodules), and benign tumors of nerve cells (neurofibromas) [1]. Other physical complications observed in NF1 patients include optic pathway gliomas, scoliosis, macrocephaly, epilepsy, chronic headaches, bending of the long bones (pseudoarthrosis), and sphenoid wing dysplasia [2]. Cognitive deficits in spatial learning and memory also accompany these more physical manifestations of NF1 [3]. Though mental retardation is not commonly seen in NF1 patients, a high proportion of children afflicted with NF1 show learning disabilities (30 – 65%) [3]. These children perform poorly on tasks requiring developed spatial memory and visual-spatial functioning. Though the cognitive manifestations of NF1 have been characterized, no substantial link between the genetic and cognitive deficits has been formed. In addition, no link has been shown between specific mutations within the causative gene and the degree of physical and mental impairment.

NF1 is caused by a heterozygous loss of function mutation within the NF1 gene located on chromosome 17q11.2. The NF1 gene encodes a ubiquitously expressed cytoplasmic protein called neurofibromin. The suspected function of neurofibromin is based on sequence homology to known GTPase Activating Proteins (GAPs) as well as through cell biological and functional studies of mutant neurofibromin [4]. Neurofibromin inactivates Ras (Ras-GTP) by converting it to Ras-GDP. Loss of neurofibromin within a cell would thus result in constitutive activation of the Ras signaling pathway, ultimately resulting in cell growth. Ras signaling has also been implicated in neuronal activity and synaptic plasticity [5].

It has been hypothesized that neurofibromin may also act as a modulator of adenylyl cyclase or may facilitate microtubule binding [5]. Studies in drosophila, cultured murine neurons, and Nf1-/- mouse embryos (E12.5) have shown that neurofibromin is necessary for the activation of adenylyl cyclase by pituitary adenylate cyclase activating peptide (PACAP) [69]. Drosophila models deficient for neurofibromin have also been used to determine if the learning deficits seen within mammalian samples are caused by the developmental abnormalities seen in NF1 or if the cognitive defects are due directly to decreased neurofibromin activity. Heat-shock induced neurofibromin was expressed in adult NF1-/- fruit flies, rescuing the learning deficits, indicating that developmental factors are not causing the cognitive deficits [10]. Heat-shock induced cAMP dependent protein kinase (PKA) expression also rescued the learning deficits in adult NF1-/- fruit flies, indicating that the cellular defect must be upstream of PKA within the adenylate cyclase signaling pathway [10]. In this Drosophila model it is hypothesized that neurofibromin acts as a GAP specific to G-proteins, influencing the interaction between G-proteins and adenylate cyclase [10]. The elucidation of auxiliary functions of neurofibromin can be facilitated by further study of such model organisms containing targeted mutations of the Nf1 gene (Drosophila and murine systems).

A mouse model of the cognitive deficits associated with Neurofibromatosis type 1 was first developed in 1994 and has since been utilized in the investigation and characterization of the disease [11, 12]. The learning deficits seen in the Nf1+/- mice include difficulties in spatial learning and decreased hippocampal long-term potentiation (LTP) [5]. Increased levels of GABA-mediated inhibition have been linked to these cognitive deficits within the mouse model and introduction of a GABAA receptor antagonist (Picrotoxin) into the knockout mouse system restores normal LTP in the hippocampus [5]. Double knockout mice heterozygous for mutations in both the Nf1 and K-ras genes (Nf1+/-/K-ras+/-) show similar performance on the hidden water maze task as wildtype mice [5]. Inactivating mutations within the K-ras gene decrease the level of functional Ras protein within the cells. Observations that the combination of Nf1 and K-ras mutations in mice results in normal cognitive function support the link between an increase in Ras activity and visual-spatial learning deficits. Ras activity within cells can also be modulated through the introduction of farnesyl-transferase inhibitors. By blocking the post-translational farnesylation of Ras protein in the Nf1+/- mutant mice, performance on visual-spatial tasks are comparable to wildtype mice, rescuing the phenotype [5].

The detailed mechanism by which diminished function of neurofibromin protein leads to defects in hippocampal long term potentiation, and subsequent deficits in cognition and learning is not fully understood. Some of the intermediate steps are dependent on gene transcription and new protein synthesis [13]. It is thus appropriate to study the cumulative effect of Nf1 gene mutation in the developing hippocampus, and characterize alterations in gene expression profiles in this model system. Here we describe the results of our studies comparing gene expression profiles in the hippocampi of Nf1+/- and wild type mice at postnatal ages 10, 15, and 20 days, a time period that is critical for syanptogenesis and synaptic remodeling in the hippocampus. Application of new high-resolution genomic technologies to the Nf1 knock-out mouse model may provide new insight into the mechanisms behind the cognitive impairment in humans with Neurofibromatosis type 1.

Results

Genes showing fold change values of ≥2.0 and corresponding p-values of ≤0.05 were visualized across the time series (post natal days 10, 15, and 20) (Fig. 1). Figure 1 shows the expression profiles of genes across the time series and includes only genes which are significantly changed at a minimum of one time point. Individual lists of genes significantly changed at each individual time point are contained in Tables 1, 2, and 3. Four genes were dysregulated at more than one time point: Ate1, Tcfap2d, Rad51l1, Arhgap8. The lists of dysregulated genes include a myriad of genes including enzymes, receptors, channel molecules, and transcription factors. All raw expression data is publicly available [14, 15].
Figure 1

Visualization of all expression fluctuations in the hippocampus across the time series. Visualization of genes in the second dataset showing a significant (p ≤ 0.05) fold change of ≥2 between Nf1+/- and wild type mice at one or more time points (n = 163). Genes showing increased expression in the mutant model appear in the red portion of the expression color spectrum with decreasing genes in the green portion. The normalized intensity is plotted on a log scale versus the postnatal age. Each line represents the expression of an individual gene.

Table 1

Genes at post natal day 10 showing fold change values of ≥2 between Nf1+/- and wild type mice (p ≤ 0.05).

Probe Set

Unigene

Fold Change

P Value

Gene Name

Gene Symbol

1421984_at

Mm.20911

12.2

0.00205

stanniocalcin 1

Stc1

1422207_at

Mm.4835

9.391

0.000624

5-hydroxytryptamine (serotonin) receptor 5A

Htr5a

1426141_at

Mm.207059

7.518

0.0351

RF-amide G protein-coupled receptor

MrgA1

1445983_at

Mm.172835

6.707

0.0139

ubiquitin-conjugating enzyme E2A, RAD6 homolog

Ube2a

1436615_a_at

Mm.2611

6.396

0.0416

ornithine transcarbamylase

Otc

1457713_at

Mm.2213

6.388

0.0281

excision repair cross-complementing rodent repair deficiency

Ercc5

1459730_at

Mm.52297

5.653

0.0329

formin binding protein 1

Fnbp1

1446315_at

Mm.282039

5.376

0.0362

ATP citrate lyase

Acly

1430486_at

Mm.341756

4.883

0.0493

RAD51-like 1 (S. cerevisiae)

Rad51l1

1425443_at

Mm.244858

4.441

0.0239

transcription factor AP-2, delta

Tcfap2d

1452431_s_at

Mm.235338

4.175

0.0242

histocompatibility 2, class II antigen A, alpha

H2-Aa

1433133_at

Mm.159671

3.708

0.0269

EDAR (ectodysplasin-A receptor)-associated death domain

Edaradd

1429566_a_at

Mm.23790

3.69

0.0369

homeodomain interacting protein kinase 2

Hipk2

1426005_at

Mm.199008

3.673

0.00896

dentin matrix protein 1

Dmp1

1429668_at

Mm.246550

3.67

0.0389

POU domain, class 4, transcription factor 1

Pou4f1

1415861_at

Mm.30438

3.651

0.0382

tyrosinase-related protein 1

Tyrp1

1427313_at

Mm.287572

3.557

0.0125

prostaglandin I receptor (IP)

Ptgir

1435663_at

Mm.9213

3.449

0.00753

estrogen receptor 1 (alpha)

Esr1

1441957_x_at

Mm.205196

3.211

0.0202

stromal cell derived factor receptor 1

Sdfr1

1422038_a_at

Mm.261384

3.19

0.0384

tumor necrosis factor receptor superfamily, member 22

Tnfrsf22

1421967_at

Mm.200886

3.031

0.0318

UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 5

B4galt5

1419085_at

Mm.41456

2.949

0.0459

Purkinje cell protein 2 (L7)

Pcp2

1456151_at

Mm.299073

2.931

0.0198

zinc finger protein 358

Zfp358

1449484_at

Mm.32506

2.929

0.00956

stanniocalcin 2

Stc2

1436490_x_at

Mm.297440

2.888

0.0446

RAN, member RAS oncogene family

Ran

1447786_at

Mm.86413

2.684

0.0443

pleckstrin homology, Sec7 and coiled-coil domains 1

Pscd1

1457684_at

Mm.277465

2.683

0.0331

heat shock protein 12B

Hspa12b

1437571_at

Mm.261602

2.572

0.023

hypermethylated in cancer 2

Hic2

1427637_a_at

Mm.89935

2.516

0.048

desmocollin 3

Dsc3

1421275_s_at

Mm.354761

2.438

0.00644

suppressor of cytokine signaling 7

Socs7

1444641_at

Mm.71996

2.351

0.0412

adenylate cyclase 3

Adcy3

1459828_at

Mm.1963

2.326

0.00118

serine/arginine repetitive matrix 1

Srrm1

1421660_at

Mm.314531

2.323

0.026

sodium channel, voltage-gated, type IX, alpha polypeptide

Scn9a

1445314_at

Mm.4866

2.302

0.000693

ets variant gene 1

Etv1

1421234_at

Mm.332607

2.248

0.0373

transcription factor 1

Tcf1

1442456_at

Mm.172679

2.215

0.0262

spermatogenesis associated 5

Spata5

1441483_at

Mm.336081

2.153

0.0398

SLIT and NTRK-like family, member 2

Slitrk2

1438597_x_at

Mm.196508

2.137

0.0365

mortality factor 4 like 1

Morf4l1

1439428_x_at

Mm.247143

2.118

0.0407

GDP-mannose 4, 6-dehydratase

Gmds

1459924_at

Mm.340818

2.088

0.0306

ATPase, H+ transporting, lysosomal V0 subunit a isoform 1

Atp6v0a1

1425429_s_at

Mm.354757

2.003

0.048

hypoxia inducible factor 3, alpha subunit

Hif3a

1427040_at

Mm.1314

0.499

0.0418

kidney cell line derived transcript 1

Kdt1

1418745_at

Mm.139817

0.498

0.0139

osteomodulin

Omd

1419230_at

Mm.342959

0.49

0.00148

keratin complex 1, acidic, gene 12

Krt1-12

1423170_at

Mm.236009

0.487

0.000269

TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor

Taf7

1419231_s_at

Mm.342959

0.487

0.00492

keratin complex 1, acidic, gene 12

Krt1-12

1457306_at

Mm.6988

0.483

0.0387

aminolevulinate, delta-, dehydratase

Alad

1432834_at

Mm.24242

0.475

0.00679

carboxypeptidase B2 (plasma)

Cpb2

1449739_at

Mm.281464

0.472

0.0126

phosphatidylserine synthase 1

Ptdss1

1460250_at

Mm.43375

0.466

0.00542

sclerostin domain containing 1

Sostdc1

1425291_at

Mm.4985

0.466

0.00137

forkhead box J1

Foxj1

1442344_at

Mm.82680

0.465

0.00971

AP1 gamma subunit binding protein 1

Ap1gbp1

1456247_x_at

Mm.18565

0.462

0.0237

LIM domain only 6

Lmo6

1450760_a_at

Mm.39999

0.462

0.0157

inhibitor of growth family, member 3

Ing3

1418082_at

Mm.10265

0.456

0.0305

N-myristoyltransferase 1

Nmt1

1427612_at

Mm.171224

0.444

0.00697

defensin beta 9

Defb9

1439051_a_at

Mm.260504

0.442

0.0497

MAP/microtubule affinity-regulating kinase 4

Mark4

1421906_at

Mm.12926

0.427

0.0224

peroxisome proliferator activated receptor binding protein

Pparbp

1416203_at

Mm.18625

0.427

0.0261

aquaporin 1

Aqp1

1444960_at

Mm.243855

0.412

0.031

cytochrome P450, family 2, subfamily u, polypeptide 1

Cyp2u1

1424273_at

Mm.29119

0.402

0.00623

cytochrome P450, family 2, subfamily c, polypeptide 70

Cyp2c70

1450995_at

Mm.2135

0.37

0.0443

folate receptor 1 (adult)

Folr1

1418554_at

Mm.2857

0.366

0.0107

adrenomedullin receptor

Admr

1424713_at

Mm.28623

0.36

0.0295

calmodulin-like 4

Calml4

1454866_s_at

Mm.44747

0.357

0.00964

chloride intracellular channel 6

Clic6

1449693_at

Mm.258589

0.353

0.0446

mitogen activated protein kinase kinase kinase 7

Map3k7

1452546_x_at

Mm.221026

0.337

0.0323

defensin beta 11

Defb11

1419662_at

Mm.4258

0.332

0.0234

osteoglycin

Ogn

1417297_at

Mm.328900

0.294

0.0313

inositol 1,4,5-triphosphate receptor 3

Itpr3

1436477_x_at

Mm.240224

0.288

0.0103

RAB2, member RAS oncogene family

Rab2

1459738_x_at

Mm.1114

0.286

0.0425

galactosidase, alpha

Gla

1439167_at

Mm.281738

0.284

0.0116

peroxisomal trans-2-enoyl-CoA reductase

Pecr

1420652_at

Mm.216321

0.27

0.0445

arginine-tRNA-protein transferase 1

Ate1

1427560_at

Mm.3410

0.259

0.0328

sine oculis-related homeobox 5 homolog (Drosophila)

Six5

1435214_at

Mm.40016

0.241

0.00726

gap junction membrane channel protein alpha 12

Gja12

1425794_at

Mm.209931

0.236

0.0234

polymerase (DNA directed), alpha 2

Pola2

1426151_a_at

Mm.272264

0.235

0.0214

syntaxin 3

Stx3

1439878_at

Mm.207365

0.208

0.0151

involucrin

Ivl

1450805_at

Mm.338890

0.202

0.0179

sarcoglycan, delta (dystrophin-associated glycoprotein)

Sgcd

1438406_at

Mm.194950

0.195

0.00559

scavenger receptor class F, member 2

Scarf2

1439457_x_at

Mm.9852

0.189

0.0278

autophagy 12-like (S. cerevisiae)

Apg12l

1444680_at

Mm.208970

0.171

0.0137

positive cofactor 2, multiprotein complex, glutamine/Q-rich-associated protein

Pcqap

1426171_x_at

Mm.193478

0.17

0.0166

killer cell lectin-like receptor, subfamily A, member 7

Klra7

1418618_at

Mm.2657

0.0828

6.20E-05

engrailed 1

En1

Table 2

Genes at post natal day 15 showing fold change values of ≥2 between Nf1+/- and wild type mice (p ≤ 0.05)

Probe Set

Unigene

Fold Change

P Value

Gene Name

Gene Symbol

1425754_a_at

Mm.1420

12.45

0.0354

butyrophilin, subfamily 1, member A1

Btn1a1

1418555_x_at

Mm.21642

6.649

0.00469

Spi-C transcription factor (Spi-1/PU.1 related)

Spic

1420992_at

Mm.10279

6.523

0.00774

ankyrin repeat domain 1 (cardiac muscle)

Ankrd1

1418358_at

Mm.331192

6.182

0.0229

mitochondrial capsule selenoprotein

Mcsp

1458958_at

Mm.209041

6.01

0.00798

neighbor of Punc E11

Nope

1447392_s_at

Mm.276736

5.357

0.0228

carboxypeptidase D

Cpd

1450439_at

Mm.248353

5.224

0.0198

host cell factor C1

Hcfc1

1435410_at

Mm.159608

4.96

0.0419

testicular cell adhesion molecule 1

Tcam1

1454032_at

Mm.126079

4.831

0.0386

neuropilin (NRP) and tolloid (TLL)-like 2

Neto2

1438414_at

Mm.39703

4.337

0.0381

fukutin related protein

Fkrp

1420652_at

Mm.216321

4.245

0.0175

arginine-tRNA-protein transferase 1

Ate1

1425069_at

Mm.264252

4.15

0.00663

similar to nuclear protein, 25 K – mouse

LOC223706

1421515_at

Mm.242728

3.998

0.0161

nuclear receptor subfamily 6, group A, member 1

Nr6a1

1447362_at

Mm.29133

3.983

0.04

budding uninhibited by benzimidazoles 1 homolog, beta

Bub1b

1456697_x_at

Mm.22480

3.814

0.0171

cyclin D binding myb-like transcription factor 1

Dmtf1

1422260_x_at

Mm.14302

3.75

0.0144

chemokine (C-C motif) receptor 5

Ccr5

1420253_at

Mm.201322

3.638

0.0362

dolichol-phosphate (beta-D) mannosyltransferase 1

Dpm1

1427825_at

Mm.272223

3.568

0.0202

solute carrier organic anion transporter family, member 1b2

Slco1b2

1458678_at

Mm.347976

3.356

0.00654

NADH dehydrogenase (ubiquinone) 1, alpha/beta subcomplex, 1

Ndufab1

1441659_at

Mm.151308

3.305

0.0274

D4, zinc and double PHD fingers, family 3

Dpf3

1417015_at

Mm.41265

3.094

0.0256

Ras association (RalGDS/AF-6) domain family 3

Rassf3

1418536_at

Mm.34421

3.034

0.0147

histocompatibility 2, Q region locus 7

H2-Q7

1437847_x_at

Mm.28275

2.999

0.0357

RNA binding motif protein, X chromosome

Rbmx

1440837_at

Mm.358604

2.771

0.031

histocompatibility 2, O region beta locus

H2-Ob

1418595_at

Mm.12966

2.751

0.041

plasma membrane associated protein, S3-12

S3-12

1422278_at

Mm.327835

2.707

0.00471

dopamine receptor 3

Drd3

1425398_at

Mm.371766

2.539

0.0134

histone 1, H2bc

Hist1h2bc

1425443_at

Mm.244858

2.53

0.0347

transcription factor AP-2, delta

Tcfap2d

1419623_at

Mm.86657

2.515

0.0308

protease, serine, 21

Prss21

1421359_at

Mm.57199

2.51

0.000164

ret proto-oncogene

Ret

1450455_s_at

Mm.89993

2.504

0.00985

aldo-keto reductase family 1, member C12

Akr1c12

1420710_at

Mm.4869

2.422

0.0149

reticuloendotheliosis oncogene

Rel

1434885_at

Mm.155687

2.357

0.0457

DNA segment, Chr 7, ERATO Doi 413, expressed

D7Ertd413e

1451463_at

Mm.291372

2.351

0.0344

Rho GTPase activating protein 8

Arhgap8

1416309_at

Mm.290015

2.299

0.00369

nucleolar and spindle associated protein 1

Nusap1

1425064_at

Mm.250265

2.272

0.00144

aryl hydrocarbon receptor nuclear translocator

Arnt

1425721_at

Mm.221688

2.245

0.0475

pleckstrin homology domain interacting protein

Phip

1421953_at

Mm.21048

2.219

0.0017

v-crk sarcoma virus CT10 oncogene homolog (avian)-like

Crkl

1426520_at

Mm.104932

2.199

0.0211

B-cell translocation gene 4

Btg4

1450104_at

Mm.3037

2.172

0.0339

a disintegrin and metalloprotease domain 10

Adam10

1436008_at

Mm.371590

2.134

0.00836

tumor protein D52

Tpd52

1419535_at

Mm.263706

2.121

0.0243

solute carrier organic anion transporter family, member 6b1

Slco6b1

1420499_at

Mm.10651

2.121

0.0318

GTP cyclohydrolase 1

Gch

1451870_a_at

Mm.253518

2.011

0.0256

bromodomain containing 4

Brd4

1445886_at

Mm.4454

0.497

0.0367

ELK3, member of ETS oncogene family

Elk3

1425690_at

Mm.218788

0.461

0.0463

beta-1,3-glucuronyltransferase 1 (glucuronosyltransferase P)

B3gat1

1441966_at

Mm.124567

0.452

0.0279

transient receptor potential cation channel, subfamily M, member 3

Trpm3

1427635_at

Mm.30355

0.438

0.0348

kinesin family member 5A

Kif5a

1418194_at

Mm.271670

0.421

0.0445

UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 10

Galnt10

1416239_at

Mm.3217

0.42

0.00011

argininosuccinate synthetase 1

Ass1

1449266_at

Mm.131408

0.415

0.0128

methyl CpG binding protein 2

Mecp2

1440072_at

Mm.210787

0.407

0.021

glucocorticoid induced transcript 1

Glcci1

1430357_at

Mm.371563

0.398

0.0139

H3 histone, family 3B

H3f3b

1425707_a_at

Mm.328720

0.387

0.0192

potassium inwardly-rectifying channel, subfamily J, member 6

Kcnj6

1446185_at

Mm.21158

0.353

0.0479

FK506 binding protein 12-rapamycin associated protein 1

Frap1

1422144_at

Mm.3510

0.328

0.0259

inhibin beta E

Inhbe

1421447_at

Mm.303355

0.298

0.000377

one cut domain, family member 1

Onecut1

1449907_at

Mm.174133

0.255

0.0278

beta-carotene 15, 15'-dioxygenase 1

Bcdo1

1421073_a_at

Mm.18509

0.237

0.0359

prostaglandin E receptor 4 (subtype EP4)

Ptger4

1420296_at

Mm.254370

0.232

0.00578

chloride channel 5

Clcn5

1418158_at

Mm.20894

0.205

0.0342

transformation related protein 63

Trp63

1448074_at

Mm.5033

0.174

0.0361

relaxin 1

Rln1

1453630_at

Mm.271953

0.122

0.00471

UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14

Galnt14

1446162_at

Mm.125979

0.0938

0.0101

poly A binding protein, cytoplasmic 5

Pabpc5

Table 3

Genes at post natal day 20 showing fold change values of ≥2 between Nf1+/- and wild type mice (p ≤ 0.05)

Probe Set

Unigene

Fold Change

P Value

Gene Name

Gene Symbol

1425947_at

Mm.240327

13.26

0.000122

interferon gamma

Ifng

1442827_at

Mm.38049

4.568

0.0446

toll-like receptor 4

Tlr4

1425478_x_at

Mm.240044

4.347

0.0178

ubiquitin-conjugating enzyme E2I

Ube2i

1450337_a_at

Mm.23788

3.618

0.0132

NIMA (never in mitosis gene a)-related expressed kinase 8

Nek8

1422411_s_at

Mm.327088

3.478

0.0376

ribonuclease, RNase A family 3

Rnase3

1422297_at

Mm.158264

2.727

0.0381

prefoldin 5

Pfdn5

1438564_at

Mm.207360

2.573

0.0405

growth arrest specific 2

Gas2

1433732_x_at

Mm.281018

2.313

0.0229

insulin-like growth factor 2, binding protein 3

Igf2bp3

1427816_at

Mm.21841

2.306

0.0137

splicing factor, arginine/serine-rich 2 (SC-35)

Sfrs2

1452349_x_at

Mm.255414

2.149

0.0043

interferon activated gene 205

Ifi205

1418604_at

Mm.4351

2.038

0.0134

arginine vasopressin receptor 1A

Avpr1a

1438156_x_at

Mm.18522

0.496

0.0254

carnitine palmitoyltransferase 1a, liver

Cpt1a

1426714_at

Mm.131618

0.488

0.00577

DNA segment, Chr 11, ERATO Doi 18

D11Ertd18e

1455332_x_at

Mm.330161

0.48

0.00869

Fc receptor, IgG, low affinity IIb

Fcgr2b

1450951_at

Mm.14910

0.478

0.0373

chondroitin sulfate proteoglycan 6

Cspg6

1423719_at

Mm.3783

0.359

0.0127

cDNA sequence U46068

U46068

1419109_at

Mm.39968

0.357

0.0432

histidine rich calcium binding protein

Hrc

1460746_at

Mm.236114

0.356

0.0339

fidgetin-like 1

Fignl1

1433382_at

Mm.79127

0.352

0.0427

dynein, axonemal, intermediate chain 1

Dnaic1

1449207_a_at

Mm.258846

0.297

0.0232

kinesin family member 20A

Kif20a

1455990_at

Mm.259374

0.279

0.00332

kinesin family member 23

Kif23

1436682_at

Mm.3532

0.273

0.0428

thymosin, beta 10

Tmsb10

1430486_at

Mm.341756

0.232

0.0143

RAD51-like 1 (S. cerevisiae)

Rad51l1

1426598_at

Mm.20477

0.222

0.0128

ubiquitously transcribed tetratricopeptide repeat gene, Y chromosome

Uty

1451463_at

Mm.291372

0.193

0.0173

Rho GTPase activating protein 8

Arhgap8

1441429_at

Mm.261591

0.188

0.036

insulin receptor substrate 4

Irs4

1452563_a_at

Mm.262676

0.109

0.00609

selected mouse cDNA on the Y

Smcy

1457582_at

Mm.20477

0.0739

0.0209

ubiquitously transcribed tetratricopeptide repeat gene, Y chromosome

Uty

1426438_at

Mm.302938

0.0533

0.0444

DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked

Ddx3y

RT-PCR validation was performed on a select group of genes showing significantly (p ≤ 0.05) regulated fold changes of ≥2 fold. As can be seen in Table 4, Affymetrix microarray fold change values correlate well with the trend of transcript levels calculated through RT-PCR reactions. Though the exact fold change values are not identical, the two assays show consistent trends of regulation.
Table 4

Affymetrix and RT-PCR fold change values for genes significantly regulated in the hippocampus of Nf1+/- mice

Gene Symbol

Gene Name

Probe ID

Fold Change

P-value

RT-PCR Fold Change

RT-PCR P-value

Stc1

stanniocalcin 1

1421984_at

12.2

0.0021

1.7592

0.0100

Htr5a

5-hydroxytryptamine (serotonin) receptor 5A

1422207_at

9.391

0.0006

2.0005

0.0580

Neto2

neuropilin (NRP) and tolloid (TLL)-like 2

1454032_at

4.831

0.0386

1.4045

0.0415

Frap1

FK506 binding protein12-rapamycin associated protein 1

1446185_at

0.353

0.0479

0.3927

0.4711

Genes significantly dysregulated at post natal days 10, 15, and 20 were entered into the GeneGo network developing program, along with proteins known to be involved in learning and memory (Tab, ErbB-2, CREB, calcium, AMPA, SH2, ShcC, NMDA receptor, TrkB, MAPK, CaM Kinase II, calcineurin, Rho-associated kinase, MAP2, peripherin, ERK1, ERK2, TARP, PAK3) [16]. A functional network was created identifying genes within the data set that are linked to these known mediators of long term potentiation (LTP).

As expected, the GeneGo networking software identified direct modulation of Ras activity (here notated H-Ras) by neurofibromin. The networking program also identified neurofibromin as a physical binding partner with both the kinesin heavy chain and amyloid beta precursor protein (APP) (Fig. 2). While no significant dysregulation of APP was seen in the data set, members of the kinesin motor protein family were downregulated in the Nf1+/- mice at post natal days 15 and 20 (Tables 2 and 3).
Figure 2

Clustering network connecting neurofibromin primary gene mutation with downstream cellular factors. Enlargement of signaling network connecting neurofibromin (Nf-1) with the dopamine 3 receptor (D3DR HUMAN) created through the GeneGo networking software. Neurofibromin is indicated as a binding partner for both the kinesin heavy chain and amyliod beta precursor protein (APP). APP binds through integrins to filamin A, a cytoskeletal organizational protein which in turn can bind to and possibly transport the dopamine 3 receptor.

Gene expression analysis shows a 2.7 fold increase in the expression of dopamine 3 receptor in Nf1+/- brains at post natal day 15. The GeneGo network development software highlights binding properties between this dopamine receptor and filamin A, a protein involved in cytoskeleton organization through binding with integrins, receptors, and second messengers [17]. The associations between integrins and filamin A and between integrins and APP seen in the GeneGo network links neurofibromin to the dopamine receptor. Here it is hypothesized that the APP and integrin proteins are essential for the transport of the dopamine receptor protein down the axon via the filamin proteins. Several other genes linked to intracellular structure and protein trafficking were also dysregulated in the dataset. Aberrant movement of these complexes within the neurons could lead to abnormal localization or abundance of receptors in neuronal processes.

Discussion

Learning and memory deficits observed in human Neurofibromatosis type 1 patients have been modeled in a Nf1 gene knock-out murine system showing well characterized spatial learning and memory deficiencies. These mutant mice exhibit increased levels of activated Ras (Ras-GTP) and increased GABA mediated inhibition. Research has shown that the cognitive deficit in this mouse model can be rescued by inactivating Ras (through genetic modification or pharmacological treatment) or by blocking postsynaptic GABA uptake [5].

We used gene expression profiling to investigate the genetic pathways leading to GABA mediated inhibition, and to link deficiency of neurofibromin to long term changes at the synapse. Differentially regulated genes at postnatal days 10, 15, and 20 were analyzed using GeneGo networking software. This network analysis identified direct interactions between NF1, APP, integrins, filamins, and kinesins. Though compound binding properties were identified in silico, these interactions must be investigated within the cells including how these interactions affect the activity of each protein or the localization of the proteins with the cell. It is known that kinesin proteins act within the nerve cell to carry proteins and cellular organelles from the cell body down neuronal processes [18]. Interaction between neurofibromin and kinesins suggests a mechanism for intracellular localization of the neurofibromin/APP complex. Current literature has identified physical interactions between NF1, APP, and kinesin-1 integral to vesicle transport in melanocytes and neurons. This study proposed that NF1 gene mutations impair vesicle trafficking through aberrant kinesin transport of both NF1 and APP [19].

Through network analysis an interaction between APP and the dopamine 3 receptor (DRD3) was idenified. DRD3, a member of the G alpha inhibitory G protein coupled receptor family, was also dysregulated in the mutant mice, showing a 3 fold increase in expression in the hippocampus. The DRD3 receptor is a member of the D2 like dopamine receptor superfamily which selectively mediates inhibition of adenylate cyclase V [20]. The DRD3 receptor expression has been localized to limbic areas of the brain, where it acts via the Go subunit and adenylate cyclase to decrease cAMP levels [20, 21]. It is unknown if alterations in expression of these receptors are involved in either GABA mediated inhibition, or in other pathways leading to the phenotypic leaning and memory deficits characteristic of NF1.

The results of our network analysis are shown in Figure 2, implying a functional connection between neurofibromin and the amyloid beta precursor protein/integrin/filamin complex, which is in turn related to the dopamine receptors (Drd3). These potential interactions between neurofibromin and APP or DRD3 might lead to new ideas about how neurofibromin is involved in cellular signaling and synaptic plasticity. Future research should include studies of APP and related signaling pathways as well as dopaminergic systems in NF1 models. This also raises the possibility of investigating these pathways in human patients using modern imaging modalities (such as positron emission tomography).

Methods

Animals (breeding, dissection, genotyping, and sexing)

Nf1+/- mice were purchased from Jackson Laboratory (symbol Nf1tm1Fcr) [22]. Breeder pairs were allowed to mate, and offspring were collected at postnatal days 10, 15, and 20. At these ages, mice were euthanized and bilateral brain regions (hippocampus, cerebral cortex, cerebellum, olfactory bulb, and basal ganglion/thalamus) dissected and immediately flash frozen in an ethanol/dry ice bath. Liver and blood were also collected from each mouse. All tissues were stored at -80°C until RNA or DNA extraction was performed.

The Nf1+/- mice contain a Neo targeting cassette, which disrupts the Nf1 gene to form the knockout allele and can be tested using primers specific for this insert. Genotyping was performed through a series of PCR reactions containing one microliter (approximately 100 ng) of sample DNA, 10 pM of primers, 1× PCR buffer, 2.25 mM MgCl2, 10 mM of each dNTP, and 1 unit of Taq Gold polymerase. The PCR cycling program started with 95°C for 5 minutes followed by 35 cycles of 94°C for 1 minute, 55°C for 1 minute, and 72°C for 1 minute. The final step was 72°C for 10 minutes followed by a 4°C hold. Genotyping and sexing primers included:

Control primers (1.2 kilobase product):

mMeC.U256 Forward 5'-GTATGATGACCCCACCTTGC

mMeC.L1452 Reverse 5'-TTCAGTCCCTTCCCGCTTTT

Neo specific primers (2 kilobase product):

Neo5' Forward 5'-GCGTGTTCGAATTCGCCAATG

Exon 32 Reverse 5'-GAAGGACAGCATCAGCATG

Y Chromosome specific primers (200 base pair product):

STS162400 Forward 5'GCAAACAACCTCATAGTCCC

STS162400 Reverse 5'CTGGATTTGTGACAAGGAGC

The reaction product was visualized by 2% agarose gel electrophoresis and the presence of bands noted. The control PCR reaction detected a segment of the MeCP2 gene on the X chromosome, and was used to monitor the integrity of template genomic DNA, and the amplification reaction. The presence of a single 2 kb band in the Neo specific reaction indicated a Nf1+/- heterozygous mouse, whereas wild type genomic DNA was represented by absence of a band. Sex was determined by PCR amplification using the Y-chromosome specific primer set. The presence of a band at 200 bp indicates a male mouse and females are shown as the absence of any product.

Affymetrix expression profiling

Four Nf1+/- mice and four age and sex matched wild type mice were analyzed at each time point. Hippocampi (~20 mg each) from two mice within a single condition were pooled and divided to yield two identical samples, and each was individually extracted, labeled, and hybridized to the Affymetrix (Murine 430 2.0) chip. Total RNA was isolated from each 40 mg tissue sample using Stratagene RTPCR Mini-prep kit (the average yield was 15 μg RNA/40 mg tissue). Extracted RNA was subsequently cleaned using the Qiagen Mini kit protocol, and the purified RNA was analyzed through agarose gel electrophoresis to insure quality.

cDNA was synthesis from 7 μg of purified total RNA, in vitro transcription, and hybridization proceeded as previously described [21]. Strict quality controls require that each RNA sample show >4 × amplification through the in vitro transcription protocol, that each scanned array should contain >30% present calls across the array, and that the 3'/5' should show consistent values >3 indicating low nonspecific hybridization. Arrays that do not satisfy these conditions were not included in the analysis and a second sample of cRNA was created utilizing a second allotment of stored total RNA from the sample.

Data analysis

Data was extracted from the array images using Affymetrix Microarray Suite version 5.1 software (MAS5.0). Raw expression data was corrected for saturation at individual probes using an in-house Array Data Manipulation program which replaces S2 values with S1 values if the S2 values are greater than 1500 (baseline normalization of 150) or the S2/S1 signal ratio is less than 0.8.

The modified gene expression data for each individual array was imported into GeneSpring v 5.0 (Agilent Technologies). For each time point, average fold changes (relative to wildtype expression data) were calculated with error bars. Genes showing expression changes with significant p-values (p ≤ 0.05) and fold change values of ≥2.0 within at least one time point were exported for functional annotation. Thereafter, the function of each gene was determined through literature searches, genes were binned into ontologic categories, and relevant biological processes and pathways identified.

Modeling the dysfunctional genetic network

The main goal of both temporal and functional clustering is to generate an integrated pathway beginning with the known primary genetic defect and ending with proteins known to be involved in causing the cognitive pathology under study. This pathway then becomes the template for later in vivo validation. The GeneGo network building algorithms (GeneGo, Inc) were used in an iterative fashion to build gene/protein interaction pathways between known NF1 pathway members (NF1, Ras, GABA) and proteins known to be involved in LTP. The gene expression changes with ≥2 fold differences at p ≤ 0.05 were used to seed the algorithms and identified new pathway members which link the primary defect to the cognitive phenotype. All raw expression data is publicly available [14, 15].

Validation of the pathogenic cascade

Quantitative Real-Time PCR – Total RNA was extracted from ~20 mg of hippocampus from 3 Nf1+/- and 3 wild type mice using the Absolutely RNA Miniprep Kit (Stratagene). Reverse transcription reactions were done using 3 μg of total RNA from hippocampus, oligo dT primers, and the Super Script III First Strand cDNA synthesis kit (Invitrogen). Resulting cDNA was amplified on the Chromo4 Four-Color Real-Time System (MJ Research) using the DyNAmo HS SYBR Green qPCR Kit (Finnzymes) and gene specific primers. Standardized and optimized primers were ordered from SuperArray Bioscience Corporation. These included primers designed for Stc1 (stanniocalcin1), Htr5a (5-hydroxytryptamine (serotonin) receptor 5A), Neto2 (neuropilin and tolloid like protein 2), and Frap1 (FK506 binding protein 12-rapamycin associated protein1). The housekeeping gene GAPD (glyceraldehydes-3-phosphate dehydrogenase) was analyzed using the primer set (f-CCAGTATGACTCCACTCACG, r-GAGATGATGACCCGTTTGGC). For amplification, the following program was employed: a 95°C heat activation step for 15 min, followed by 40 cycles of 94°C for 10 sec, 55°C for 25 sec, 72°C for 30 sec, incubate at 72°C, and plate reads at both 77°C and 81°C. A melting curve was created evaluating the products between 60–95°C reading every 0.2°C.

Primer set specificity was verified through melting curve analysis. The threshold for amplification was set as the number of cycles necessary to reach logarithmic fluorescence accumulation (C(T)). Fold difference in cDNA concentration was calculated using the formula F = 2((MH-MG)-(WH-WG)) where F = fold difference, MH = mutant housekeeping gene (GAPD) C(T), MG = mutant gene of interest C(T), WH = wild type housekeeping gene (GAPD) C(T), WG = wild type gene of interest C(T) [24, 25]. Statistical significance of the resulting fold change values was calculated with a two-tailed t-test assuming unequal variance.

Declarations

Acknowledgements

This research was supported in part by research grants to DAS from the Department of Defense (CDMRP grant no. DAMD17-02-1-0642), the NIH Neuroscience Blueprint (U24NS051872), and the State of Arizona. VN is supported by funds from the Barrow Neurological Foundation.

Authors’ Affiliations

(1)
Developmental Neurogenetics Laboratory, Barrow Neurological Institute, St Joseph's Hospital and Medical Center
(2)
Neurogenomics Division, Translational Genomics Research Institute

References

  1. Rutkowski JL, Wu K, Gutmann DH, Boyer PJ, Legius E: Genetic and cellular defects contributing to benign tumor formation in neurofibromatosis type 1. Hum Mol Genet. 2000, 9: 1059-1066. 10.1093/hmg/9.7.1059.View ArticlePubMedGoogle Scholar
  2. North K: Neurofibromatosis type 1. Am J Med Genet. 2000, 97: 119-27. 10.1002/1096-8628(200022)97:2<119::AID-AJMG3>3.0.CO;2-3.View ArticlePubMedGoogle Scholar
  3. Ozonoff S: Cognitive impairment in neurofibromatosis type 1. Am J Med Genet. 1999, 89: 45-52. 10.1002/(SICI)1096-8628(19990326)89:1<45::AID-AJMG9>3.0.CO;2-J.View ArticlePubMedGoogle Scholar
  4. Feldkamp MM, Angelov L, Guha A: Neurofibromatosis type 1 peripheral nerve tumors: aberrant activation of the Ras pathway. Surg Neurol. 1999, 51: 211-218. 10.1016/S0090-3019(97)00356-X.View ArticlePubMedGoogle Scholar
  5. Costa RM, Federov NB, Kogan JH, Murphy GG, Stern J, Ohno M, Kucherlapati R, Jacks T, Silva AJ: Mechanism for the learning deficits in a mouse model of neurofibromatosis type 1. Nature. 2002, 415: 526-530. 10.1038/nature711.View ArticlePubMedGoogle Scholar
  6. Guo HF, The I, Hannan F, Bernards A, Zhong Y: Requirement of Drosophila NF1 for activation of adenylyl cyclase by PACAP38-like neuropeptides. Science. 1997, 276: 795-798. 10.1126/science.276.5313.795.View ArticlePubMedGoogle Scholar
  7. Tong J, Hannan F, Zhu Y, Bernards A, Zhong Y: Neurofibromin regulates G protein-stimulated adenylyl cyclase activity. Nat Neurosci. 2002, 5: 95-96. 10.1038/nn792.View ArticlePubMedGoogle Scholar
  8. Dasgupta B, Dugan LL, Gutmann DH: The neurofibromatosis 1 gene product neurofibromin regulates pituitary adenylate cyclase-activating polypeptide-mediated signaling in astrocytes. J of Neurosci. 2003, 23: 8949-8954.Google Scholar
  9. The I, Hannigan GE, Cowley GS, Reginald S, Zhong Y, Gusella JF, Hariharan IK, Bernards A: Rescue of a Drosophila NF1 mutant phenotype by Protein Kinase A. Science. 1997, 276: 791-794. 10.1126/science.276.5313.791.View ArticlePubMedGoogle Scholar
  10. Guo HF, Tong J, Hannan F, Luo L, Zhong Y: A neurofibromatosis-1-regulated pathway is required for learning in Drosophila. Nature. 2000, 403: 895-898. 10.1038/35002593.View ArticlePubMedGoogle Scholar
  11. Jacks T, Shih TS, Schmitt EM, Bronson RT, Bernards A, Weinberg RA: Tumour predisposition in mice heterozygous for a targeted mutation in Nf1. Nat Genet. 1994, 7: 353-61. 10.1038/ng0794-353.View ArticlePubMedGoogle Scholar
  12. Cichowski K, Shih TS, Jacks T: Nf1 gene targeting: toward models and mechanisms. Sem in Can Bio. 1996, 7: 291-298. 10.1006/scbi.1996.0037.View ArticleGoogle Scholar
  13. Martin KC, barad M, Kandel ER: Local protein synthesis and is role in synaose-specific plasticity. Curr OpinNeurobiol. 2000, 10: 587-592. 10.1016/S0959-4388(00)00128-8.View ArticleGoogle Scholar
  14. Translational Genomics Research Institute. [http://www.tgen.org/neurogenomic/data]
  15. NIH Neuroscience Microarray Consortium. [http://arrayconsortium.tgen.org]
  16. Johnston MV, Alemi L, Harum KH: Learning, memory, and transcription factors. Ped Res. 2003, 53: 369-374. 10.1203/01.PDR.0000049517.47493.E9.View ArticleGoogle Scholar
  17. Ueda K, Ohta Y, Hosoya H: The carboxy-terminal pleckstrin homology domain of ROCK interacts with filamin-A. Biochem Biophys Res Commun. 2003, 301: 886-90. 10.1016/S0006-291X(03)00048-2.View ArticlePubMedGoogle Scholar
  18. Brady ST: A novel brain ATPase with properties expected for the fast axonal transport motor. Nature. 1985, 317: 73-75. 10.1038/317073a0.View ArticlePubMedGoogle Scholar
  19. De Schepper S, Boucneau JM, Westbroek W, Mommaas M, Onderwater J, Messiaen L, Naeyaert JM, Lambert JL: Neurofibromatosis Type 1 Protein and Amyloid Precursor Protein Interact in Normal Human Melanocytes and Colocalize with Melanosomes. J Invest Dermatol. 2006, [Epub ahead of print]Google Scholar
  20. Robinson SW, Caron MG: Selective inhibition of adenylate cyclase type V by the dopamine D3 receptor. Mol Pharmaco. 1997, 52: 508-514.Google Scholar
  21. Zaworski PG, Alberts GL, Pregenzer JF, Im WB, Slightom JL, Gill GS: Efficient functional coupling of the human D3 dopamine receptor to Go subtype of G proteins in SH-SY5Y cells. Brt J of Pharmac. 1999, 128: 1181-1188. 10.1038/sj.bjp.0702905.View ArticleGoogle Scholar
  22. Jackson Laboratory. [http://www.jax.org]
  23. Mintz MB, Sowers R, Brown KM, Hilmer SC, Mazza B, Huvos AG, Meyers PA, Lafleur B, McDonough WS, Henry MM, Ramsey KE, Antonescu CR, Chen W, Healey JH, Daluski A, Berens ME, Macdonald TJ, Gorlick R, Stephan DA: An expression signature classifies chemotherapy-resistant pediatric osteosarcoma. Cancer Res. 2005, 65 (5): 1748-54. 10.1158/0008-5472.CAN-04-2463.View ArticlePubMedGoogle Scholar
  24. Mariani L, McDonough WS, Hoelzinger DB, Beaudry C, Kaczmarek E, Coons SW, Giese A, Moghaddam M, Seiler RW, Berens ME: Identification and validation of P311 as a glioblastoma invasion gene using laser capture microdissection. Cancer Res. 2001, 61: 4190-4196.PubMedGoogle Scholar
  25. Lehmann U, Gloeckner S, Kleeberger W, von Wasielevsky HFR, Kreipe H: Detection of gene amplification in archival breast cancer specimens by laser-assisted microdissection and quantitative real-time polymerase chain reaction. Am Pathol. 2000, 156: 1855-1864.View ArticleGoogle Scholar

Copyright

© Donarum et al; licensee BioMed Central Ltd. 2006

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Advertisement