Cell line
The hiPSC line (DYR0100), derived from a human prepuce cell of a healthy boy donor, and was procured from Hunan Fenghui Biotechnology Company (ATCC-ACS-1011TM).
Gene editing
sgRNA design and testing
sgRNAs were designed in silico using the CRISPR Design Tool (http://crispr.mit.edu/). The sgRNAs were designed to target the NM_001080.3: c.727_735del region of ALDH5A1. Two sgRNAs with a high fraction of efficacy were selected. The two oligonucleotides for sgRNAs were cloned into two VB UltraStable competent cells. The sgRNA1 sequence was: 5′-TATAGCTTGCAAGCCAGGCT-3′, and the protospacer adjacent motif (PAM) sequence was GGG. The sgRNA2 sequence was: 5′-TTATAGCTTGCAAGCCAGGC-3′, and the PAM sequence was TGG.
hiPSC cells (300,000/well) were plated in a 6-well culture plate. On the following day, the cells were transfected with 2 µg sgRNA1 and Cas9-carrying plasmid using DNA Lipofectamine™ Stem transfection reagent (ThermoFisher, Cat# STEM00003). Cells were cultured for 24 h and then screened by flow cytometry (BD FACS Aria SORP, USA). sgRNA1 was more efficient than sgRNA2, and they had editorial effects.
ssDNA for homologous directed repair
Single-stranded donor oligonucleotides were synthesized by Vector Builder and provided at 10 µM concentrations. The sequence was TTTTTTTTTTTTTTCAGTTTGGTAAATTTTGGCAAGTTTGCTTTTCTCTTTATAGCAGGCTGG GATTCCTTCAGGTGTATACAATGTTTTCCCTGTTCTCGAAAGAATGCCAAGGA. At the time of transfection, 2 µl was added to each well of the 6-well plate.
Cell culture
hiPSCs culture and transfection
hiPSCs were cultured in a PGM1 medium (Cellapy, CAT# CA3001500) with 0.5% Plasmocin prophylactic on matrix-coated (Corning Matrigel hESC-Qualified) plate and maintained at 37 °C in humidified air with 5% CO2. Cells were passaged with Cellapy Cell Dissociation Reagent (Stem cell, CAT# 07174) every 3–4 days and plated at a density of 2 × 104 cells/cm2 with a split ratio of around 1:6. During cell generation, 10 µM Y-27632 (STEMCELL Technologies, CAT# 72,302) was added.
Cells were transfected with a complex formed with the Cas9 plasmid (VB190801_1165nbd) and two sgRNA plasmids (VB190801-1166xkk and VB190801-1168fdu), constructed by VectorBuilder, using Lipofectamine Stem transfection reagent (Invitrogen, CAT #STEM00001).
The detailed steps were as follows:
|
Steps
|
Tube
|
Component
|
Per well of a 6-well plate
|
|---|
|
1
|
1
|
Opti-MEM™ I Medium
|
100 µl
|
|
Lipofectamine™ Stem Reagent
|
4 µl
|
|
2
|
2
|
Opti-MEM™ I Medium
|
100 µl
|
|
DNA
|
2 µg*
|
|
3
|
Add diluted DNA to diluted Lipofectamine Stem Reagent
|
|
4
|
Incubate for 10 min at room temperature
|
|
5
|
Add DNA-lipid complex to cells (200 µl/per well)
|
|
6
|
Incubate and monitor the transfected stem cells at 37 °C for 2 days
|
- *Equimolar amounts of Cas9 plasmid DNA and gRNA plasmid DNA were added
Screening of positive clones with targeted homozygosity
After 48 h of transfection, the cells were harvested with StemPro Accutase (Stem Cell, CAT. #At-104) and sorted on a BD FACS Aria SORP (BD Biosciences). eGFP-positive cells were collected, re-sorted to remove false-positive cells, and cultured in 12-well plates. For homologous directed repair screening, 1 week after cultivation, a portion of the cells of each colony was removed and DNA was extracted using the DNeasy Blood and Tissue Kit (Qiagen) for PCR amplification and sequencing. Sequencing results confirmed successful editing and cells were selected in a 10-cm dish by clone ring (Sigma, Aldrich, CAT# C7983-50EA).
Chromosome analysis and whole-genome sequencing for iPSC
Cultured cells were incubated in 50 ng/ml colcemide solution (Gibco, CAT# 15210–040) for 1 h, subjected to hypotonic treatment in 0.075 M KCl for 20 min at 37 °C, fixed with Carnoy solution (3:1 v/v methanol/acetic acid) twice for 20 min each and spread on a wet cooled microscopic slide with a plastic transfer pipette to obtain chromosome preparations for karyotype analysis. After the specimen was air-dried, the slide was incubated on a heating plate at 82 °C for 2.5 h. After 10 min of Giemsa staining, changes in karyotype were observed under a phase-contrast microscope.
The two successfully edited homozygous cell lines and the unedited cell lines were sent to BGI for genome-wide sequencing to confirm that no undesired editing was present in the cell lines.
Immunofluorescence staining
The cells were fixed in 4% PFA for 20 min and washed three times with phosphate-buffered saline (PBS). Cells were permeabilized with 1 ml of 0.5% Triton-X 100 for 20 min and blocked with 5% BSA for 1 h at room temperature. Cells were incubated with primary antibodies (against OCT4, TRA-1–60, SSEA, and NANOG) at 4 °C for overnight and then washed three times with PBS. Cells were then incubated with secondary antibodies in the dark at room temperature for 2 h. Nuclei were stained with 0.5 µg/ml DAPI, and images were acquired with a ZOE fluorescence cell imager (Bio-Rad).
Induction and identification of NSCs
iPSC Neural Induction Medium (Gibco, CAT# A1647801) was used to differentiate human iPSCs into NSCs following the manufacturer’s instructions. The staining was performed to identify NSCs as in Section above. Primary antibodies were Sox1 and Nestin antibodies.
Real-time PCR analysis
Total mRNA was extracted from cells by Trizol (Invitrogen). First-strand cDNA synthesis was performed on 1 µg of the total RNA. Real-time PCR for ALDH5A1, GAPDH and β-ACTIN was performed using ChamQ™ Universal SYBR-qPCR Master Mix (version7.1, Vazyme); reactions were performed in triplicate. The following primers were used for gene detection: ALDH5A1-1, forward 5′ -GGC ACC AGT TAT CAA GTT CG-3′ and reverse 5′ -ACT CCA AAA GGG CAC TC-3′; ALDH5A1-2, forward 5′ -AGT CAT CAC CCC GTG GAA TTT-3′ and reverse 5′-GAG AAG GGC GTG TCT TCG G-3′; ALDH5A1-3, forward 5′-AGG GGA GGC AAT TTG TAC TGA-3′ and reverse 5′-GTG GTG CAA CAG GAT CTT TCC-3′; GAPDH, forward 5′-GCACCGTCA AGG CTG AGA AC-3′ and reverse 5′-TGG TGA AGA CGC CAGTGG A-3′; and β-ACTIN, forward 5′–3′ CATGTACGTTGCTATCCAGGC and reverse 5′–3′ CTCCTTAATGTCACGCACGAT (Table 1). The target gene (ALDH5A1) expression levels were calculated using the comparative threshold cycle (Ct) method with the following formula: ΔCt = Ct (gene of interest) − Ct (GAPDH and β-ACTIN); the 2−ΔΔCt was calculated with the following formula: ΔΔCt = ΔCt (control group) − ΔCt (experimental group) to determine the relative expression. In each experiment, each sample was analyzed in triplicate. The result of β-ACTIN is not show in the figure.
Western blot
Cells were lysed with RIPA lysis buffer (Beyotime, Beijing, China) containing 1% PMSF (Beyotime, Beijing, China). Protein (15 μg) was loaded on 10% SDS-PAGE gels for electrophoresis and transferred to PVDF membranes. The membranes were blocked with 5% non-fat dry milk in TBS containing 0.1% Tween 20 for 1.5 h at room temperature and then incubated with antibody for SSADH (AffinitY, Cat# DF12820) and β-actin (Multi Sciences, Hangzhou, China) at 4 °C overnight. The membranes were then incubated with HRP-conjugated secondary antibody (Multi Sciences, Hangzhou, China) for 2 h at room temperature. Signals were detected using film by darkroom exposure (Servicebio, G2019, China). In each experiment, each sample run on the SDS-PAGE gel in duplicate.
High-performance liquid chromatography–tandem mass spectrometry (HPLC–MS/MS)
GABA in iPSC and NSC cell lines was determined with HPLC–MS/MS, as previously described [19]. The samples used were total protein obtained by two duplicate experiments (n = 2).
cDNA sequencing
RNA from wild-type and mutant cell lines was extracted and reverse transcribed to cDNA. cDNA was amplified using the following primers: F1: TTCCTGTCGCCGTCGTTGC, R1: ATCCTACAAGCCCCCGTAACAC. For segmented sequencing analysis, we used the following primers: F2-1: GGTCCTCAAGCAGCCCATA, F2-2: TTTGTAAAAGCATTCGCCG, R2: AAAATAACCTGCTAACCCAACATC; F3: GATGCCGTTTCTAAAGGTGC, and R3: TTACAAGGACTGGATGAGTTCTG. The locations of the primers are shown in Fig. 3. (Table 1).
