Skip to main content

Table 3 RT-qPCR primer list and amplification efficiency

From: Identification of the neurotransmitter profile of AmFoxP expressing neurons in the honeybee brain using double-label in situ hybridization

mRNA Forward 5′ 3′ Reverse 5′ 3′ Efficiency (%)
AmVAchT AGGGCGTCGGTTCCGCTTTC CAGCATCACTCCGTCCGCCA 89.7
AmVGluT AACGCCCCGTGAGGGTAGCA GACGCAATGGGGGCCGTTCA 96.3
AmVMAT ATTGTCGGCCCCCTCACCCA GAGCACGACGAACCAACGCC 99.7
AmVIAAT CGCCGTATTGCGAGGCGGTT CGCGTTGTCCAGTCGTCGTGT 99.8
AmRpL32 TGTGCTGAAATTGCTCATGGGGG AGAACGTAACCTTGCACTGGCATAA 100.3
AmGapDH CGGTTTTGGCCGTATTGGCCGT AATGGCAACAACCTGAGCACCGAA 99.4