Skip to main content

Table 1 Primer pairs used for ChIP analysis and qPCR analysis

From: The Bdnf and Npas4 genes are targets of HDAC3-mediated transcriptional repression

ChIP analysis
GeneForwardReverse
Npas4 ChIP5′ AGCCCCTTCTCATCCTTTGC5′ CTTCCTTGCTTCCCGGTCTT
Bdnf ChIP5′ CACGGCTCTTCCTAGCACTT5′ TGTTGATGAGACCCTTTCCATGT
cFos ChIP5′ AGTCTCATCCCCTGACCCTG5′ CCTCAGCTGGCCGCTTTAT
Foxp1 ChIP5′ CTTGGAGGATGTTGCTCTGC5′ GAGAGGAGGATTTCCAGAAGTT
Stat3 ChIP5′ GTAAGAGGCTCACGGTCTCG5′ AACCGCTGAATTACAGCCCC
qPCR analysis
TranscriptForwardReverse
Bdnf exon I5′- CAGGGCAGTTGGACAGTCAT5′ TACGCAAACGCCCTCATTCT
Bdnf exon II5′ TTCGGCTCACACTGAGATCG5′ CAGTATACCAACCCGGAGCTT
Bdnf exon III5′ TTGGAGGGCTCCTGCTTTCT5′ CTGGGCTCAATGAAGCATCCAG
Bdnf exon IV5′ ACTGAAGGCGTGCGAGTATT5′ TGGTGGCCGATATGTACTCC
Bdnf exon V5′ AAACCATAACCCCGCACACT5′ CTTCCCGCACCACAGAGCTA
Bdnf exon VI5′ GATGAGACCGGGTTCCCTCA5′ TTGTTGTCACGCTCCTGGTC
Bdnf exon VII5′ ACTGTCACCTGCTTTCTAGGG5′ GAGTTCCGCAGACCCTTTCA
Bdnf exon VIII5′ GTGCTCAGGCTAATCCTCGTT5′ CTTTCTCCTGGGATGCACAGT
Bdnf exon IXA5′ ACGGCGTGAACAGAGATCAT5′ ACGGTTTCTAAGCAAGTGACG
Npas45′ CAGATCAACGCCGAGATTCG5′ GACACCCTTGCGAGTGTAGAT
Actin5′ GCCATGTACGTAGCCATCCA5′ GGAGCGCGTAACCCTCATAG
  1. Table lists the primers used for ChIP and qPCR analysis. The exon specific Bdnf primers described in Nair et al. [83] were used for the analysis