Skip to main content

Advertisement

TableĀ 3 Gene primers

From: A 72-hour high fat diet increases transcript levels of the neuropeptide galanin in the dorsal hippocampus of the rat

Gene symbol Gene name Forward and reverse
GAPDH Glyceraldehyde 3-phosphate dehydrogenase GGGAAACCCATCACCATCTT
CCAGTAGACTCCACGACATACT
BDNF Brain-derived neurotrophic factor GAGACAAGAACACAGGAGGAAA
CCCAAGAGGTAAAGTGTAGAAGG
FTO Fat mass and obesity-associated protein CTGTGGAAGAAGATGGAGAGTG
CAGGACGGCAGACAGAATTT
GAL Galanin CCATTGACAACCACAGATCATTTA
CAACACTTCCTAGTCTCCCTTC
GALR1 Galanin receptor 1 GTTCCCATAGGTGTACAGAGTTC
GGTGTCTTAGTCCACAGGATTAC
GALR2 Galanin receptor 2 GGACCAAAGGGCATCTAACA
CCTACAATCCTCGGTCTTTAGC
HAT1 Histone acetyltransferase 1 TGTTTCTCCCGGGAAAGATTAC
CCCGTCTAGCATGTTGCTTAT
HDAC2 Histone deacetylase 2 CTGTCAAAGGTCACGCTAAATG
GTCCAACATCGAGCAACATTC
HDAC4 Histone deacetylase 4 AGCTGCAGGAGTTTGTTCTC
CTGTGCTGTGTCTTCCCATAC
INSR Insulin receptor CCCTGTGACCCATGAAATCTT
CGCCGATAGCTCACTTCATATAG
OBRB Leptin receptor, long form GGTTGGATGGACTAGGGTATTG
CAGAATTCAGGCCCTCTCATAG
ORXR Orexin receptor CTCCTCATCGTGACACTGAAAG
GAGGAAGAGAAACTCCCACAAG
RHEB1 Ras homolog enriched in brain 1 GAGCCCACCACCTCAATAAT
GGGAAAGTGCAGATACCGATTA
SOCS3 Suppressor of cytokine signaling 3 ACCTTTCTTATCCGCGACAG
CACTGGATGCGTAGGTTCTT
SYN1 Synapsin 1 GGACGGAAGGGATCACATTATT
ACCACAAGTTCCACGATGAG
  1. Sequences for all primers used in qRT-PCR reactions.