Skip to main content

Table 3 Gene primers

From: A 72-hour high fat diet increases transcript levels of the neuropeptide galanin in the dorsal hippocampus of the rat

Gene symbol Gene name Forward and reverse
GAPDH Glyceraldehyde 3-phosphate dehydrogenase GGGAAACCCATCACCATCTT
BDNF Brain-derived neurotrophic factor GAGACAAGAACACAGGAGGAAA
FTO Fat mass and obesity-associated protein CTGTGGAAGAAGATGGAGAGTG
HAT1 Histone acetyltransferase 1 TGTTTCTCCCGGGAAAGATTAC
OBRB Leptin receptor, long form GGTTGGATGGACTAGGGTATTG
RHEB1 Ras homolog enriched in brain 1 GAGCCCACCACCTCAATAAT
SOCS3 Suppressor of cytokine signaling 3 ACCTTTCTTATCCGCGACAG
  1. Sequences for all primers used in qRT-PCR reactions.