Skip to main content

Table 2 List of primers encoding markers of bulbar interneuron proliferation and differentiation

From: Secreted factors from olfactory mucosa cells expanded as free-floating spheres increase neurogenesis in olfactory bulb neurosphere cultures

Genes Forward Primer Reverse Primer Tm References
Arx CAGCATTTGGCAGGCTCT AGGATGTTGAGCTGCGTGAG 56°C [59]
Dlx5 ATGACAGGAGTGTTTGACAG CTAATAAAGCGTCCCGGAGG 56°C [60]
Mash1 AGCAGCTGCTGGACGAGCA CCTGCTTCCAAAGTCCATTC 56°C [61]