Skip to main content

Table 1 List of PCR primers

From: Ethanol induces cell-cycle activity and reduces stem cell diversity to alter both regenerative capacity and differentiation potential of cerebral cortical neuroepithelial precursors

Primer Name Sequence Product Size Accession #/Reference
TS primer 5'-ATTCCGTCGAGCAGAGTT-3'   [105]
ACX primer 5'-GCGCGG [CTTACC]3CTAACC-3'   
R-Tert_Forward GGTCTTCCGCACGTTGGTTG 349bp [106]
Rat_Nestin_Forward TGCAGCCACTGAGGTATCTG 1061bp Acc#: M34384
Cyclophilin A_Forward TGGTCAACCCCACCGTGTTCTTCG 372bp Acc#: M19533