Skip to main content

Table 2 EMSA oligonucleotide sequences

From: TGF-β1 induction of the adenine nucleotide translocator 1 in astrocytes occurs through Smads and Sp1 transcription factors

Oligonucleotide Sequence (5'-3')
Oligo 1 Sense ATGCGCGCTGCGCGCTCGCCGGGGTCCCTCCTCCTC
Oligo 1 Anti-sense GAGGAGGAGGGACCCCGGCGAGCGCGCAGCGCGCAT
Oligo 2 Sense CCCTCCTCCTCTCGCGAGACGCCGA
Oligo 2 Anti-sense TCGGCGTCTCGCGAGAGGAGGAGGG
Oligo 1Δ Sense ATGCGCGCTGCGCGCTCGCCGGGGTCCCTC
Oligo 1Δ Anti-sense GAGGGACCCCGGCGAGCGCGCAGCGCGCAT
PAI Sense TCGAGAGCCAGACAAGGAGCCAGACAAGGAGCCAGACAC
PAI Anti-sense GTGTCTGGCTCCTTGTCTGGCTCCTTGTCTGGCTCTCGA