Skip to main content

Table 1 Sense and anti-sense oligonucleotides for Smads 2, 3 and 4

From: TGF-β1 induction of the adenine nucleotide translocator 1 in astrocytes occurs through Smads and Sp1 transcription factors

Gene Sequence (5'-3') Position Annealing temp (°C)
Smad2 TCAGTGCGATGCTCAAGCATGTCC 1515-1538 66
  AGACCAAGCAGCAGCACACACCTC 1926-1903  
Smad3 ACGAGCTGAACCAGCGAGTTGG 1006-1027 45 (5 cycles)
  TGGTGCACATGCGAGTCAACTGG 1407-1385 57 (35 cycles)
Smad4 ATGCCCATTGCGGACCCACAG 1755-1775 66
  GGAAGACTGGACTGCCACTTGCG 2253-2231