Skip to main content

Table 1 List of specific primers

From: Adult ciliary epithelial stem cells generate functional neurons and differentiate into both early and late born retinal neurons under non-cell autonomous influences

Gene

Sequence

Size(bp)

To

 Accession N.

Palmdelphin

F: 5′- ATTCTCTTCCTCTCTCCCTGCTGC -3′

102

55

NM_023245.3

R: 5′- GCTACCATAAATCAAGGTGCGTCC-3′

Rab27

F: 5′- AGCCAGCAGAAAAGAAATGTGC-3′

155

55

NM_001082553.1

R: 5′- ATTGGGGTCAGGGGAGAAAGAC-3′

Tyrosinase

F:5′-CTGTGCCTCCTCTAAGAACTTGTTG-3′

163

57

NM_011661.4

R:5′-ACGGTCATCCACCCCTTTGAAG-3′

Ki67

F:5′CCAGAGCTAACTTGCGCTGAC-3′

148

54

NM_001081117.2

R:5′GCTTGATGGTGACCAGGTGAG-3′

Cyclin D1

F:5′-ACCCTGACACCAATCTCCTCAAC-3′

118

56

NM_171992

R:5′-ATGGATGGCACAATCTCCCTCTGC-3′

Otx2

F:5′-TCTGGTCTCACTCCATCCCC-3′

172

51

NM_144841.3

R:5′-TGGTTTACTGCTTCGGAGGG-3′

Lhx2

F:5′-GAGACGTGCAGGCATCTGG-3′

133

55

NM_010710.3

R:5′-CATCGCTAGCTGGGTTCTGG-3′

Pax6

F:5′-CACCAGACTCACCTGACACC-3′

193

54

NM_001244198.1

R:5′-TCACTCCGCTGTGACTGTTC-3′

Rx

F:5′-ATCCCAAGGAGCAAGGAGAG-3′

256

58

AF135839

R:5′-TTCTGGAACCACACCTGGAC-3′

β-III Tubulin

F:5′-TTTTCGTCTCTAGCCGCGTG-3′

157

54

NM_023279.2

R:5′-CTGCAGGTCTGAGTCCCCTA-3′

Map2

F:5′-ATTAACCAACCACTGCCGGA-3′

188

52

NM_001039934.1

R:5′-ATTTGTACATTTCCGCCCCC-3′

Nav 1.1

F:5′- CATACATCTTTCGGGGGAATCTC-3′

195

54

NM_018733.2

R:5′- CATCTTTTTTGTCTGGCTTGGG-3′

Nav 1.7

F:5′- GAAGACCCCGAAGAAGAAGAAGG-3′

194

54

NM_009135.2

R:5′-GCATTGAACCTGAAGATGACTCTGC-3′

Kv 1.3

F: 5′- CGAGCGTGTGGTCATCAACATC-3′

128

58

NM_008418.2

R: 5′- CATTGCGGAGTGGGTCAAAG-3′

Kv 1.5

F: 5′- CATCAAGGAAGAGGAGAAGCCC -3′

127

56

NM_145983.2

R: 5′- GAGAATGACCAAGACCGACACG -3′

Ath5

F:5′- CAGGACAAGAAGCTGTCCAA-3′

173

56

AF071223

 

R:5′- GGGTCTACCTGGAGCCTAGC-3′

   

Brn3b

F:5′-AGACTTCGAGCAGGAGATG-3′

322

60

NM_138944.2

R:5′-CTTGATCTTCATGGTGCTAGG-3′

Isl1

F:5′- TTCTCCGGATTTGGAGTGGC-3′

188

53

NM_021459.4

R:5′- CACGCATCACGAAGTCGTTC -3′

Thy1

F:5′- ACCAAGCCAGATGCCTGAAA -3′

147

54

NM_009382.3

R:5′- GGATGGTCCACAAAGGCTCA-3′

Sncg1

F:5′-AAGAGGCAGTAGCAGCAGAGACAG-3′

131

56

NM_011430.3

R: 5′- CAACACCTTCCTTGGCAATGG-3′

Rpf1

F:5′- AGTTACTAATGCACAAGGACA-3′

380

57

NM_010127.3

R:5′-CTCAAAGCTGAAGAAGAGGAG-3′

Crx

F:5′-CCTGTAAAAGAACTGACAAGAGGGG-3′

153

55

NM_001113330.1

R:5′- AAGGCATTGACTGAATAGTGAGGC-3′

Nrl

F:5′-TTCTGTCTCATCTTCCAGGCTGTAG-3′

120

50

NM_001136074

R:5′-ACAACTTCTTCTCCCCCTTCCTC-3′

Nr2e3

F:5′-CCGAAACTTGTGCTAAACTGGAGC-3′

183

56

NM_013708.4

R: 5′- GGAAAGGCAGGTTGGAAAACAC-3′

RK

F:5′-GCTGAACAAGAAGCGGCTGAAG-3′

238

56

NM_011881

R:5′-TGCTGTGTAGTAGATGGCTCGTGG-3′

   

Rhodopsin

F:5′-TCAAGCCTGAGGTCAACAAGC-3′

422

62

BC013125

R:5′-ACTTCCTTCTCTGCCTTCTGAGTG-3′

Gnat1

F:5′- AGATGAAGATTATCCACCAGGACG-3′

136

55

NM_008140.2

R:5′- TCTCCATACTGAATGTTGAGCGTG-3′

Phosducin

F:5′-TGCTGTGGATGTGGAGTCTTTCC-3′

105

51

NM_001159730.1

R:5′-GCTTATTCAATGTCCTCGTCTTCC-3′

Recoverin

F:5′-GGAAAAGAAACAGTGATGGGCAC-3′

188

57

NM_009038.2

R:5′-AAAAGGAAGCAGGAGTTGTGTCC-3′

Rod Arrestin

F:5′-TGTCCTCACCCAACTCCAAGAGAG-3′

153

56

NM_009118.2

R:5′-ACCTCAAAGTCAACCCCACAGC-3′

GAPDH

F: 5′-ACAGTCCATGCCATCACTGCC -3′

266

60

NM_017008.3

 

R: 5′-GCCTGCTTCACCACCTTCTTG-3′