Skip to main content

Table 1 List of specific primers

From: Adult ciliary epithelial stem cells generate functional neurons and differentiate into both early and late born retinal neurons under non-cell autonomous influences

Gene Sequence Size(bp) To  Accession N.
Palmdelphin F: 5′- ATTCTCTTCCTCTCTCCCTGCTGC -3′ 102 55 NM_023245.3
Rab27 F: 5′- AGCCAGCAGAAAAGAAATGTGC-3′ 155 55 NM_001082553.1
Tyrosinase F:5′-CTGTGCCTCCTCTAAGAACTTGTTG-3′ 163 57 NM_011661.4
Ki67 F:5′CCAGAGCTAACTTGCGCTGAC-3′ 148 54 NM_001081117.2
Cyclin D1 F:5′-ACCCTGACACCAATCTCCTCAAC-3′ 118 56 NM_171992
Otx2 F:5′-TCTGGTCTCACTCCATCCCC-3′ 172 51 NM_144841.3
Lhx2 F:5′-GAGACGTGCAGGCATCTGG-3′ 133 55 NM_010710.3
Pax6 F:5′-CACCAGACTCACCTGACACC-3′ 193 54 NM_001244198.1
β-III Tubulin F:5′-TTTTCGTCTCTAGCCGCGTG-3′ 157 54 NM_023279.2
Map2 F:5′-ATTAACCAACCACTGCCGGA-3′ 188 52 NM_001039934.1
Nav 1.1 F:5′- CATACATCTTTCGGGGGAATCTC-3′ 195 54 NM_018733.2
Nav 1.7 F:5′- GAAGACCCCGAAGAAGAAGAAGG-3′ 194 54 NM_009135.2
Kv 1.3 F: 5′- CGAGCGTGTGGTCATCAACATC-3′ 128 58 NM_008418.2
Kv 1.5 F: 5′- CATCAAGGAAGAGGAGAAGCCC -3′ 127 56 NM_145983.2
Ath5 F:5′- CAGGACAAGAAGCTGTCCAA-3′ 173 56 AF071223
Brn3b F:5′-AGACTTCGAGCAGGAGATG-3′ 322 60 NM_138944.2
Isl1 F:5′- TTCTCCGGATTTGGAGTGGC-3′ 188 53 NM_021459.4
Thy1 F:5′- ACCAAGCCAGATGCCTGAAA -3′ 147 54 NM_009382.3
Sncg1 F:5′-AAGAGGCAGTAGCAGCAGAGACAG-3′ 131 56 NM_011430.3
Rpf1 F:5′- AGTTACTAATGCACAAGGACA-3′ 380 57 NM_010127.3
Crx F:5′-CCTGTAAAAGAACTGACAAGAGGGG-3′ 153 55 NM_001113330.1
Nr2e3 F:5′-CCGAAACTTGTGCTAAACTGGAGC-3′ 183 56 NM_013708.4
Rhodopsin F:5′-TCAAGCCTGAGGTCAACAAGC-3′ 422 62 BC013125
Gnat1 F:5′- AGATGAAGATTATCCACCAGGACG-3′ 136 55 NM_008140.2
Phosducin F:5′-TGCTGTGGATGTGGAGTCTTTCC-3′ 105 51 NM_001159730.1
Recoverin F:5′-GGAAAAGAAACAGTGATGGGCAC-3′ 188 57 NM_009038.2
Rod Arrestin F:5′-TGTCCTCACCCAACTCCAAGAGAG-3′ 153 56 NM_009118.2