Skip to main content

Table 3 Primers used for validation of stress-responsive genes by RT-qPCR

From: Fluoxetine prevents development of an early stress-related molecular signature in the rat infralimbic medial prefrontal cortex. Implications for depression?

Gene ID Symbol Sense (5-3) Antisense (5-3) Amplicon size (bp)
Glyceraldehyde-3-phosphate dehydrogenase Gapdh GAAGGGCTCATGACCACAGT GGATGCAGGGATGATGTTCT 117
Calcium/calmodulin-dependent protein kinase II alpha Camk2a GCCTGGACTTTCATCGATTC GGTACTGAGTGATGCGGATGT 141
Mammalian target of rapamycin (serine/threonine kinase) mTOR TTGGATGTTCCAACCCAAGT CAGGCCTTGGTTACCAGAAA 106
Neurotrophic tyrosine kinase, receptor, type 2 Ntrk2 TGGAGGGCGACCCACTCATCA TCAGCTCGG TGGGCGGGTTA 123
Neurotrophic tyrosine kinase, receptor, type 3 Ntrk3 CATCCGCTGGATGCCACCTGAAA AAGACACGGCCTTGGGTGATGCA 50
Phosphoinositide-3-kinase, catalytic, beta polypeptide Pik3cb CCTGCGACAGATGAGTGATG CAATCCTCCGGTTGTCAAGT 134
V-raf murine sarcoma viral oncogene homolog B1 Braf CATGGCGACGTGGCAGTGAAAATG TGAGGTGTGGGTGCTGTCACATTC 50
Glyceraldehyde-3-phosphate dehydrogenase-3-prime Gapdh-3 GGCTGGCATTGCTCTCAA GAGGTCCACCACCCTGTTG 88
Glyceraldehyde-3-phosphate dehydrogenase-5-prime Gapdh-5 GACAGCCGCATCTTCTTG CACCGACCTTCACCATCTTG 63