Skip to main content

Advertisement

Table 2 Accession number, DNA sequence, and product sizes of primers for Kainate receptor subunits and VGLUTs.

From: Evidence for a role of glutamate as an efferent transmitter in taste buds

Gene Accession # Forward Primer (5'→3') Reverse Primer (5'→3') Product (bp)
GluR5 NM_010348 TGCCTAGGAGTCAGTTGTGTGCTT AGTGAGGTTGCAGTTCCTCTGTGT 549
GluR6 NM_010349 GTGCCATCTTGGATTTGGTGCAGT ACATCAGAGCAGCATCAGTCGTCA 498
GluR7 NM_001081097 TCACACAGAGGAACTGCAACCTCA TGATAACCGCATCCGTCTTGACCA 441
KA1 NM_175481 TGCTTCCTGCTTGGCTCTTGAT AGGCATTCTGCTTTGGCACA 487
KA2 NM_008168 TGATGCCAATGCGTCCATCT ATGTTGAGGCTGCGCACAAA 210
VGlut1 NM_182993 ACCTGTTCTGGTTGCTTGTCTCCT GTTCATGAGCTTTCGCACGTTGGT 398
VGlut2 NM_080853 AGCCTGTCATGGGATATGGAGCAA ATTATCGCGTAGACGGGCATGGAT 360
VGlut3 NM_182959 TCACATCCTTGCCTGTCTATGCCA TGAGGAACACATTCTGCCACTCCT 525