Skip to main content

Table 1 Nucleotide sequences for primers used in RT-PCR studies.

From: Voltage-gated sodium channels in taste bud cells

Target (Accesion no.) Sequence (5'-3') Amplicon size (bp)
Gustducin (Gnat3) AGTACTTCGCAACCACCTCCAT (F) 249
   [Genebank: NM_001081143] GTCACTGCATCAAACACAA (R)  
T1R2 (Tas1r2) TAGGAAAAGACAGGGGGAGTGG (F) 208
   [Genebank: NM_031873] GGGGGTGTAGAGAAGCGAGAAT (R)  
TRPM5 CTCCCAGCAGCCCCAAGAAATG (F) 312
   [Genebank: NM_020277] TGGGTCAGGGGTCAGAAAGAAA (R)  
PKD2L1 GGTGAGATTCCAACAGAGG (F) 202
   [Genebank: NM_181422] CACCACATATTAGTCCAAAAGA (R)  
β-actin CGTTGACATCCGTAAAGACC (F) 244
   [Genebank: NM_007393] AGGGGCCGGACTCATCGTA (R)  
GAPDH AGGGCATCTTGGGCTACACTG (F) 310
   [Genebank: NM_008084] TATTATGGGGGTCTGGGATGGA (R)  
SCN1A CTTTGCTGAGCTGGGTTTGT (F) 227
   [Genebank: NM_018733] GCAGGAGGAAGCGGGGATTTA (R)  
  GTGACTGTGTAAAGGGGAGATA (F) 331
  CACACCGGGAAAAGAGTT (R)  
SCN2A ATGCGGGAAAATGCTATGAC (F) 325
   [Genebank: NM_001099298] TAACTTTCCACTACTCTACC (R)  
  CAAGAGATTTCAAGGGGAGCAG (F) 298
  TTGGCAAGATCATTTCACTAAC (R)  
SCN3A AAAGCGGGTCCTGGGTGAG (F) 336
   [Genebank: NM_018732] GGAAGGAGGAGAGGTGGTAGAG (R)  
  ACGCCACCCAGTTCATAGAGTT (F) 290
  CTTGTTTGCGCTTCAGAGTGGT (R)  
SCN4A GTGGGGCTCTACAGGGCTTGAC (F) 271
   [Genebank: NM_133199] CATGGGGGTGAGAGGAGTAG (R)  
  TTGGGGAACGGGGCTTTGA (F) 223
  GCTGGGGGACCTGGGCTCTTA (R)  
SCN5A TGTCCCTCCCTGGCACTCACTT (F) 278
   [Genebank: NM_021544] TGCCCCTCCCTCCTTCCGTCTA (R)  
SCN7A CCATGGCTGCGGGAGAC (F) 239
   [Genebank: NM_009135] CATTTTGCCTTAAGCGGTAGC (R)  
  CCTTCTGTTGGGATTTCTTATT (F) 325
  ATGTCGAGGCAGTGGATTC (R)  
SCN8A GCAGATGGAGGAGCGGTTCGTG (F) 279
   [Genebank: NM_001077499] CCGCTGCTGCTTCTCCTTGTCG (R)  
  TGGGAGACAGTGGGGAGTTGG (F) 295
  GTCGGGCTTTGTCACGCTGTCG (R)  
SCN9A AGCCCATACTAGCAGATTCCTC (F) 291
   [Genebank: NM_018852] TATATTCATGGCTACTTACTCA (R)  
SCN10A AGAGATGGCACCAACCTACAG (F) 302
   [Genebank: NM_009134] ACCCCTATGCGACAGTGC (R)  
  CGTTGGTCCCCGGAGATAAGAT (F) 345
  GGGAGCCCACCGTTGTCATTTG (R)  
SCN11A GCGAACAAGCGGCGGACTC (F) 287
   [Genebank: NM_011887] TACTTATGGCAGGGTTTTGACT (R)  
  GGAGGAGGAATGTGCCGCTGTC (F) 237
  GTGAGTCCGCCGCTTGTTCGC (R)  
  1. Primers correspond to mouse sequences. F is forward primer and R is reverse primer.