Skip to main content

Table 2 Hub genes primers used in this study

From: Identification of hub genes in the subacute spinal cord injury in rats

Gene Name Forward primer Reverse primer
Itgb1 Integrin subunit β1 GGAGATGGGAAACTTGGTGGT TAGAGTTTCCAGACAGTGTGCC
Fcgr2b Fc gamma receptor IIb TCCAAGCCTGTCACCATCAC TGGCAGCTACAGCAATTCCA
Ptprc Protein tyrosine phosphatase receptor type C TGACTCGGAAGAAACCAGCA AGTCTGCTTTCCTTCTCCCC
S100a4 S100 calcium binding protein A4 CAAATACTCAGGCAACGAGGG CACATCATGGCAATGCAGGAC
Cd63 Cd63 GGGGCCTGCAAAGAGAACTA TTGTCCAAAATGGTGGCCGT
Lgals3 Galactose-specific lectin 3 AGGCTCCTCCTAGTGCCTAT CCTCCAGGCAAGGGCATATC
Lamc1 Laminin subunit gamma 1 TCTTGGACCTTACAGCCCGT GTGCACACCACTTCCTTTGTC
Vav1 Guanine nucleotide exchange factor 1 AGGAGTGTCTGGGAAGGGTG AGTTCCACAATGTCCCCAGG
Shc1 Shc adaptor protein 1 TGTGAATCAGAGAGCCTGCC TCATCCCAAGCTGAGCCATC
Casp4 Cysteine peptidase 4 GTGACAAGCGCTGGGTTTTT TCTGCACAGCCTTGTGAACT
Mapk12 Mitogen-activated protein kinase 12 CCATTCATGGGCACTGACCT GTCATCTCACTGTCCGCCTG
Vegfa Vascular endothelial growth factor a AAGGCGCGCAAGAGAGC AATTGGACGGCAATAGCTGC