Skip to main content

Table 1 Oligonucleotide primer sequences for quantitative reverse transcriptase polymerase chain reaction

From: Overexpression of the receptor for advanced glycation end-products in the auditory cortex of rats with noise-induced hearing loss

Gene Primer sequence (forward) Primer sequence (reverse) Annealing temperature (°C) Product size (bp) RefSeq Number
TNFα 5'- CGTCAGCCGATTTGCCATTT -3' 5'- TCCCTCAGGGGTGTCCTTAG -3' 60 88 NM_012675.3
IL6 5'- AGAGACTTCCAGCCAGTTGC -3' 5'- TGAAGTCTCCTCTCCGGACT -3' 60 88 NM_012589.2
IL1β 5'- CACCTTCTTTTCCTTCATCTTTG -3' 5'- GTCGTTGCTTGTCTCTCCTTGTA -3' 60 241 NM_031512.2
NFκB 5'- TGTCTGCACCTGTTCCAAAGA -3' 5'- TGCCAGGTCTGTGAACACTC-3' 60 143 NM_199267.2
RAGE 5'- GGAAGGACTGAAGCTTGGAAGG -3' 5'- TCCGATAGCTGGAAGGAGGAGT -3' 60 102 NM_053336.2
GAPDH 5'- ATTGTTGCCATCAACGACCC -3' 5'- TGACTGTGCCGTTGAACTTG -3' 60 94 NM_017008.4