Skip to main content

Table 1 Primers for real-time RT-PCR analysis

From: SCN11A gene deletion causes sensorineural hearing loss by impairing the ribbon synapses and auditory nerves

Target Sequence (5′ to 3′)
Forward primer Reverse primer
Nav1.1 TTCAGGGGCTATCGAGGC TGCTGAATAATGAGTGTACCAAAAT
Nav1.9 GAAAAAGTTAGGTGGCCAAGACAT GTTGGGCTGGCCTTCAGATT
GAPDH GGAATGCCTACCTTGCCCTG ATGTCTTGGCCACCTAACTTTT