Skip to main content

Table 2 RNA probe names used for in situ hybridization

From: Identification of the neurotransmitter profile of AmFoxP expressing neurons in the honeybee brain using double-label in situ hybridization

Probe name Primers 5′–3′ Ref. seq of cds Length (nt)
AmFoxP GAGAAACCGCTGGACGTTTC NM_001104949 847
  CGTTGCGCCGGAAGTAGCAG   
AmVGlut GGCCCCCATTGCGTCACA XM_016914051.1 631
  AATGCCAGCCACAACCAGAAACAGTA   
AmGad AATGGTGAACGTCTGCTTCTGGTAT XM_391979 806
  ACTTACGTGCTATGAGTATCCTTTG   
AmVAchT CTCGGGCGCGTTGATAGACAGGAT XM_006562557.2 605
  CGCCGAACACGTGGGGGAAGAA   
AmVMAT AAGGCGTTGGTTCGTCGTGCTC XM_392061.6 855
  CTTCTTTCGTTGGCGGTGCTCGTAA   
D2-like/AmDop3 CAGCGCATTCGTTAATCTGA NM_001014983.1 534
  GCCCAGACCAACAGTATCGT   
  1. Primer sequences, reference sequence IDs and probe length are given. The AmFoxP-probe sequence containing plasmid was kindly given by Prof. Taketoshi Kiya, Kanazawa University (Japan). The AmGad primer pair was adopted from Kiya et al. [58]