Skip to main content

Table 2 Reference and target genes PCR primer sequences (5′–3′), amplicon size

From: Modulation of the expression of genes related to the system of amyloid-beta metabolism in the brain as a novel mechanism of ceftriaxone neuroprotective properties

Symbol Sequence (5′–3′) Amplicon size (bp)
Reference genes  
Actb GTTCGCCATGGATGACGATATCG CATCACACCCTGGTGCCTAG 139
B2m TGCCATTCAGAAAACTCCCCA GAGGTGGGTGGAACTGAGACA 104
Hprt1 ACAGGCCAGACTTTGTTGGA TGGCTTTTCCACTTTCGCTG 123
Mapk6 CTCGATGAGTCGGAGAAGTCCC TGTTGGCTGACAGGTGTCTCT 115
Target genes  
Bace1 GGACAACCTGAGGGGAAAGTC GTACTGGACAGCTGCCTTTGGTA 168
Ace2 TCATTCGATATTACACAAGGACCA AGCAACTTCTGCCCAGCTT 130
Mme GCTGTGGGGAGGCTTTATGT AATTGCCAGGGCCTTCTCTT 165
Ece1 TTAGCGGGAGGTGCATCCAAA CCTCGGAGAGTGAGTCCACC 111
Ide GGCCTGAGCTATGATCTCCA GATCGCATGTACGCCTCTTTG 164
Epo ATGGGGGTGCCCGAACG TACCTCTCCAGAACGCGACT 122