Skip to main content

Advertisement

Table 1 Primer sequences for RT-PCR gene expression analysis

From: Poly(ADP-ribose) polymerase inhibitors activate the p53 signaling pathway in neural stem/progenitor cells

Gene Sense primer (5′–3′) Anti-sense primer (5′–3′) Cycles Product (bp)
Parp1 TCGATGGGAAAGTCCCACAC CATTCTGAGCCTTGAGGGCC 28 600
Parp2 GACAATCGAGACTCTGTGAA AGACTGGTAACCGGCCTTGA 28 600
Gapdh ACCACAGTCCATGCCATCAC TCCACCACCCTGTTGCTGTA 28 452
Cdkn1a GTGATTGCGATGCGCTCATG TCTCTTGCAGAAGACCAATC 26 387
Fas ATGCTGTGGATCTGGGCTGT GTTTTCAGGTTGGCATGGTT 28 190
Pidd ATGGCTGCAGTGTTGGAGGG CTCTGAGAGATGGTTGTGAG 28 500
Tnfrsf10b ATGGAGCCTCCAGGACCCAG GAGCTCCAATCAGCAGCACT 28 643
Pmaip1 ATGCCCGGGAGAAAGGCGCG GGTTACTAAATTGAAGAGCT 28 308
Bbc3 CCTCAGCCCTCCCTGTCACCAG GGGTGAGGGTCGGTGTCGAT 35 232
Perp ATGCTGCGCTGCGGCCTGGC GGAACAACCAATCAAGATGA 28 500
Ccng1 ATGATAGAAGTACTGACAAC GGTGTCGTGAACGAGTGAAT 24 500
Trp53 GGAGACATTTTCAGGCTTATGG AGAAGGGACAAAAGATGACAGG 28 232