Skip to main content

Table 1 The primer list

From: Interleukin-1 receptor (IL-1R) mediates epilepsy-induced sleep disruption

Primer Sequence 5′ to 3′ Primer type
10774 CTCGTGCTTTACGGTATCGC Mutant forward
20665 GGTGCAACTTCATAGAGAGATGA Wildtype forward
20666 TTCTGTGCATGCTGGAAAAC Common