Skip to main content

Table 1 Primers for actb (β-actin), egfp (enhanced green fluorescent protein), rho (rhodopsin), gnat2 (guanine nucleotide-binding protein G protein), pde6h (phosphodiesterase 6H), opn1lw2 (opsin 1 cone pigments long-wave-sensitive) and pde6c (phosphodiesterase 6C) were designed complementary to Expressed Sequence Tags (ESTs) identified after BLAST analysis of EST databases

From: A method for isolation of cone photoreceptors from adult zebrafish retinae

Gene F/R Primer sequence Product size (bp) Melting temperature (°C) Annealing temperature (°C)
actb F CGAGCAGGAGATGGGAACC 100 61.0 53
  R CAACGGAAACGCTCATTGC   58.0  
egfp F ATGGTGAGCAAGGGCGAGGAGCTGT 713 68.0 63
  R TACAGCTCGTCCATGCCGAGAGTGATCC   70.0  
rho F AGAACCATGCCATCATGGGG 138 60.1 55
  R GAGTGCGGGTGTAGTAGTCG   59.9  
gnat2 F ACGGTCAAACTTCTGCTGCT 394 60.0 50
  R TGCAGATTCTGTCCATTTCG   55.0  
pde6h F GACCACTCGCACCTTCAAGA 99 59.9 55
  R ACAGTGATGTCTGTGCCGAG   60.0  
opn1lw2 F TGATGGCTCTGAGGTGTCCA 105 60.5 53
  R TCCAGTTCTTCCCTCTTGTTCA   58.9  
pde6c F CACAGTTCCTGGGATGGTCC 116 60.0 55
  R CGGAGTGGCTTTGGTCTGAT   60.0  
  1. It shows forward (F) and reverse (R) primer sequences with their product size (bp), melting temperatures and annealing temperatures