Skip to main content

Table 1 Primers used for real time PCR experiments

From: Neuroprotective effects of HTR1A antagonist WAY-100635 on scopolamine-induced delirium in rats and underlying molecular mechanisms

Gene Primers
Forward (5′3′) Reverse (3′5′)
HTR3B TCTCCTGACCTGCCCTATGT TCTGCCGGATGTGGTAAGTG
CHRNA4 CCTGACACGGGCAGTAGAAG ACCACCACGTCCCTAGATCA
HTR7 CGTGATCAGCATCGACAGGT TCACATTCTGAGCCCATCCG
DRD1 GAGGCTCCATCTCCAAGGAC ACTGTGTGTGACAGGTTGGA
Chrm1 TACCTCCCTGTCACGGTCAT GTGACCTCTCTGAGCTGCTG
HTR1B GTGTGGGTCTTCTCCATCTCG GCTTCCACATAGATACGGCCA
HTR1A GACCACGGCTACACCATCTAC CTGTCCGTTCAGGCTCTTCTT
  ATGGATGTGCTCAGCCCTGGTCAGG CCTGACCAGGGCTGAGCACATCCAT
GAPDH TGATGGGTGTGAACCACGAG ATCACGCCACAGCTTTCCAG