Skip to main content

Table 1 Sequences of primers used for RT-PCR.

From: Time-dependent biphasic modulation of human BDNF by antidepressants in neuroblastoma cells

Primers Sequence
UBC fwd atttgggtcgcggttcttg
exI fwd cacttgagtctccaggacagc
exII fwd caacggatttgtccgaggtgg
exIII fwd atgcctcactgagcccagttcc
exIV fwd cggagcagctgccttgatgg
exVIa/b fwd ctggagccagaatcggaacc
exVII fwd aacccacatctctacccatcc
exVIb-IXbd fwd ggaagaaggagaacttgaagc
exIX fwd actctggagagcgtgaatgg
UBC rev tgccttgacattctcgatggt
exIX rev1 atccaacagctcttctatcacg
exIX rev2 atactgtcacacacgctcagc
exIX rev3 cgtagaagtattgcttcagttgg