Skip to main content

Table 1 Comparison of average microarray and qPCR results for 6 selected genes. 3 genes downregulated in Hdh-KO cells are shown in blue, 3 genes upregulated in Hdh-KO cells are shown in red. The average signals obatined in Microarray and qPCR experiments are shown for each gene. Also shown are primers used for qPCR experiments and the fold change calculated from microarry and qPCR data by dividing average Hdh-KO signal to average Hdh-HET signal.

From: Elucidating a normal function of huntingtin by functional and microarray analysis of huntingtin-null mouse embryonic fibroblasts

Gene GeneBank Acc # Microrray Q-PCR
   HET KO Fold Primers (FP/RP) HET KO Fold
Hdh NM_010414 303.7 -0.9 DOWN CGTGAGCATCTGCCAACATT
CACACCGAGGATCAGGAGAGT
404.3 2.0 -202.2
Sox-2 NM_011443 233.7 -5.6 DOWN GATGCACAACTCGGAGATCAG
GCTTCTCGGTCTCGGACAA
16615.9 18.4 -903.0
Tcf2 NM_009330 255.6 7.3 -35.0 CACCTGACAGTAAAATGCAGATCA
GAGTGTGTGCTGTGGATATTCGT
4513.7 2.6 -1736.0
Cart1 NM_172553 -9.3 286.9 UP CCCTGAGAACGGAGCTCACT
TTGGCCCTTCGATTTTGAA
12.5 45701.8 3656.1
Esm1 NM_023612 -35.6 498.6 UP GCGAGGAGGATGATTTTGGT
GCATTCCATCCCGAAGGT
19.7 2966.9 150.6
Pitx2 NM_011098 124.8 1811.8 14.5 CCGAGTCCGGGTTTGG
TTGCGTTCCCGCTTTCTC
21.3 368.2 17.3