Skip to main content

Table 3 List of primers for neurotrophic/growth factors

From: Secreted factors from olfactory mucosa cells expanded as free-floating spheres increase neurogenesis in olfactory bulb neurosphere cultures

Genes Forward Primer Reverse Primer Tm References
aFGF ACCGAGAGGTTCAACCTGCC GCCATAGTGAGTCCGAGGACC 58°C Our laboratory
Galectin-1 TCAAACCTGGGGAATGTCTC TCAGCCTGGTCAAAGGTGAT 52°C [62]
NGF ACCATCTCAGGCCTTTCCTT TGTTGGGTGGCCTAGGTTAG 52°C Our laboratory
VEGFA GAGAGAGGCCGAAGTCCTTT TTGGAACCGGCATCTTTATC 52°C Our laboratory