Skip to main content

Table 1 List of primers for neural stem progenitor cell markers

From: Secreted factors from olfactory mucosa cells expanded as free-floating spheres increase neurogenesis in olfactory bulb neurosphere cultures

Genes Forward Primer Reverse Primer Tm References
Cyclophilin TGAGCACTGGGGAGAAAG AGGGGAATGAGGAAAATATGG 51°C modified from [55]
Hes1 CACGCTCGGGTCTGTGCTGAGAGC ATGCCAGCTGATATAATGGAG 58°C [56]
Hes5 GTGGAGATGCTCAGTCCCAAG TGTAGTCCTGGTGCAGGCTC 55°C [56]
Nestin AGTGTGAAGGCAAAGATAGC TCTGTCAGGATTGGGATGGG 54°C [57]
Notch1 GGTGAACAATGTGGATGCTG GTGGAGACAGAGTGGGTGT 52°C [58]
Sox2 TTACCTCTTCCTCCCACTCC TGATTGCCATGTTTATCTCG 56°C Our laboratory