Skip to main content

Table 2 Primers for RT-PCR

From: Expression of Galpha14 in sweet-transducing taste cells of the posterior tongue

Protein & Gene Accession # Forward Primer (5'→3') Reverse Primer (5'→3') Product bp Anneal °C
Gα14 Gna14 NM_008137 attagctacttcccagagtacaca gctcagatcaccctctgtct 256 62°C
    * tcatgcaacagagggacttg * agggccatgctcaattacac 294 60°C
Gαq Gnaq NM_008139 gtcgactacttcccagaatatgat agtccaggacggcaataaat 333 62°C
    * aacacacaccatccgtcaga * ggcaagcagtggtctctagc 229 60°C
Gα11 Gna11 NM_010301 agcccaagtcctgagtttga tgccaagtcagagtggagaa 236 60°C
Gαgus Gnat3 NM_001081143 gcaaccacctccattgttct agaagagcccacagtctttgag 286 58°C
PLCβ2 Plcb2 NM_177568 gagcaaatcgccaagatgat ccttgtctgtggtgaccttg 163 60°C
SNAP25 Snap25 NM_011428 ggcaataatcaggatggagtag agatttaaccacttcccagca 310 58°C
T1R2 Tas1r2 NM_031873 aagcatcgcctcctactcc ggctggcaactcttagaacac 114 58°C
T1R3 Tas1r3 NM_031872 gaagcatccagatgacttca gggaacagaaggacactgag 283 58°C
TrpM5 Trpm5 NM_020277 gtctggaatcacaggccaac gttgatgtgccccaaaaact 234 58°C
β-actin Actb NM_007393 ccctgtgctgctcacc gcacgatttccctctcag 328 58°C
  1. Primers marked * (Gα14 and Gαq) are located closer to the mRNA 3' end and were only used on amplified RNA from pools of GFP-expressing cells (Fig. 2).