Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 2 Sequence of oligonucleotides

From: The role of the t-SNARE SNAP-25 in action potential-dependent calcium signaling and expression in GABAergic and glutamatergic neurons

Primer Bases Sequence (5'-3') Reference
VGLUT1 forward 747–776 AGGAGGAGCGCAAATACATTGAGGATGCCA BC054462
VGLUT1 reverse 866-837 TGATGGCATAGACGGGCATGGACGTAAAGA  
β-actin forward 1033–1062 TGCTCTGGCTCCTAGCACCATGAAGATCAA NM007393
β-actin reverse 1231-1202 AAACGCAGCTCAGTAACAGTCCGCCTAGAA  
Pan SNAP-25 forward 58–82 CAGCTGGCTGATGAGTCCCTGGAAA AB003991
SNAP-25a reverse 207-172 TTGGTTGATATGGTTCATGCCTTCTTCGACACGATC AB003992
SNAP-25b reverse 267-234 CACACAAAGCCCGCAGAATTTTCCTAGGTCCGTC