Skip to main content

Table 1 Gene-specific primer sets for RT-PCR

From: Reciprocal regulation of nuclear factor kappa B and its inhibitor ZAS3 after peripheral nerve injury

Gene forward primer/reversed primer PCR product size (bp)
NGF 481 TCATCCACCCACCCAGTC 498
834 TCTTGCAGCCTTCCTGCT 817
354
β-actin 382 CACCCTGTGCTGCTCAC 398
598 GAGGGAGCGCGTAACCCT 581
217
ZAS1 6832 ACTCCCATCTCCCCAGAAGT 6851
7081 ACGGTTGCAAGGTTATTTGC 7062
250
ZAS2 7211 ATGGGGCAGTATCTGCAAAG 7229
7395 TGAGAATGGAGGGGAAGATG 7376
185
ZAS3 1693 CCCTCACAGGTCTCCCTGAA 1712
2280 GGCCAGCTTCTGCTTGATGG 2261
588
138
ZAS3 6056 TCCTGAGATCTAAGCAGAAG 6075
6665 GAGTCTGAGTCAGAGTCCTC 6646
601
422