Skip to main content

Advertisement

Table 1 Primer sequences and cycling conditions in RT-PCR

From: Differentiation of human bone marrow stem cells into cells with a neural phenotype: diverse effects of two specific treatments

  Lenght of amplified Primer sequences Cycles
Nestin 220 bp 5'GCCCTGACCACTCCAGTTTA3'
5'GGAGTCCTGGATTTCCTTCC3'
33 cycles:
30 sec, 94°C
30 sec, 55°C
30 sec, 72°C
Vimentin 200 bp 5'GGGACCTCTACGAGGAGGAG3'
5'CGCATTGTCAACATCCTGTC3'
30 cycles:
30 sec, 94°C
30 sec, 55°C
30 sec, 72°C
NF-M 333 bp 5'TGGGAAATGGCTCGTCATTT3'
5'CTTCATGGAAGCGGCCACTT3'
35 cycles:
30 sec, 94°C
60 sec, 55°C
90 sec, 72°C
NSE 329 bp 5'TGAACACAGACGCTATGCGCTCAG3'
5'CACCTTTATGTGAGTGGACACAGA3'
30 cycles:
60 sec, 94°C
60 sec, 60°C
120 sec, 72°C
Hes1 349 bp 5'ACACGACACCGGATAAACCAA3'
5'CGAGTGCGCACCTCGGTA3'
25 cycles
30 sec, 94 °C
30 sec, 60 °C
30 sec, 72 °C
GAPDH 347 bp 5'GCCAAAAGGGTCATCATCTCTG3'
5'CATGCCAGTGAGCTTCCCGT3'
25 cycles:
30 sec, 96°C
60 sec, 58°C
30 sec, 74°C