Skip to main content

Advertisement

Table 1 Primers and oligonucleotide probes used for confirmation of results.

From: Genomic responses in rat cerebral cortex after traumatic brain injury

Gene Primer/oligonucleotide probe sequence (nts) Product (bp) Acc. no
PAT F: 5'-GAAGCTAGAGGCTGAGGATC- 3'
R: 5'-GTGCAGTCTCCCTCCTTCAC- 3'
233 L00091
S-100 F: 5'-GGACCTGAGAGTGCTCATGG- 3'
R: 5'-GCATGCAATGATGAGCCCCG-3'
222 J03627.1
IGF-II F: 5'-GACTGAGTTGGGGCAAATAC- 3'
R: 5'-CAGGTGTTAGGAAGGTGCTC- 3'
211 AA899788
CD-44 F: 5'-CCGACCTTCCCACTTCACAG- 3'
R: 5'-TCTCCTCGCAGGACCAGAAG- 3'
5'- ATCACTGGTGGCCAGGGTGCTCCCA ATAAAGAAGGCGTCATCCC-3' (44-mer)
200 AA817820
OPN F: 5'-CTGCCAGCACACAAGCAGAC- 3'
R: 5'-ACTCCTTGGACTGCTCCAGG- 3'
5'-TCCTGATCAGAGGGCACGCTCAGAC GCTGGGCAACTGGGATGACC-3' (45-mer)
323 M14656
TIMP-1 F: 5'-CGAGACCACCTTATACCAGCG-3'
R: 5'-CAGGAAGCTGCAGGCAGTGAT-3'
216 L31883
TIMP-2 F: 5'-TGCACCCGCAACAGGCGTTTT-3'
R: 5'--TTCCTCCAACGTCCAGCGAGA-3'
224 L31884
VTN F: 5'-ATCGACGCTGCCTTCACTCG-3'
R: 5'-TGGCGCCATCAGAGGATCTG-3'
373 U44845
  1. Nts = nucleotides, bp = base pairs, acc. no = accession number