Skip to main content

Table 1 Forward and reverse primers used for PCR amplification

From: Neural stem cells express melatonin receptors and neurotrophic factors: colocalization of the MT1receptor with neuronal and glial markers

Gene Primers (5'→3') Nucleotides Size(bp)
GDNF atgggatgtcgtggctgtctg 58–98 643
  tctctggagccagggtcagat 700–680  
BDNF ggatgaggaccagaaggttgc 2342–2362 390
  ttgtctatgcccctgcagcct 2731-2711  
NGF gcagacccgcaacatcactgt 484–504 517
  agccttcctgctgagcacaca 1000-980  
Nestin aggaaccaaaagagacaggtg 4141–4161 653
  ttcctcagatgagaggtcaga 4793-4773  
GFAP cctcaagaggaacatcgtggt 1119–1139 592
  acactggagtcatcacctgga 1710-1690  
β-Tubulin III tagtggagaacacagacgaga 600–620 442
  ctgctgttcttactctggatg 1041-1021  
MT1 tgagtgtcatcggctcgatat 1–21 397
  tagtaactagccacgaacagc 397-377  
MT2 tgctgcatctgtcatagtacc 4–24 297
  acatggttaggaaactgcgca 346-326  
GAPDH ttcaccaccatggagaaggc 1147–1166 237
  ggcatggactgtggtcatga 1383-1364