Skip to main content

Table 1 Primer list used for quantitative RT-PCR

From: Nestin-positive mesenchymal stem cells favour the astroglial lineage in neural progenitors and stem cells by releasing active BMP4

Primers Sequence Tm
BMP2 Forward CCAAGGTTAGTGACTCAGAACAC 52
BMP2 Reverse TCATCTTGGTGCAAAGACCTGC 52
BMP4 Forward ACTGCCCCACCTTCTCTGAG 50
BMP4 Reverse TTCTCCAGATGTTCTTCGTG 50
LIF Forward GCAACCTCATGAACCAGATC 52
LIF Reverse CAACTTGGTCTTCTCTGTCC 52
CNTF Forward ATTCGTTCAGACCTGACTGC 50
CNTF Reverse CCTGATGGAAGTCACCTTCA 50
GAPDH forward GACCCCTTCATTGACCTCAACTACATG 48–55
GAPDH Reverse GCCTTCTCCATGGTGGTGAACAC 48–55