Skip to main content

Table 2 Primers used in ChIP-qPCR analysis

From: Differential effects of AdOx on gene expression in P19 embryonal carcinoma cells

Gene Forward primer Reverse primer
nanog -1524/-1373 AGAGGCAGACAGTGGTGACGA CCACAGCCACCATACTACTACTG
nanog -951/-782 GGCAAACTTTGAACTTGGGATGTGGAAATA CTCAGCCGTCTAAGCAATGGAAGAAGAAAT
nanog -545/-365 GCTCTTTCTTCAGACTTGCGTT GAGTTTCCTCTTCCATTCTTTCTAC
nanog -252/+17 GGGGATGTCTTTAGATCAGAGG CCAAATCAGCCTATCTGAAGG
nanog +1079/+1317 TGTCCCCTTTTTTCTGAGCTT CACTTTTCCCACCTCCAAAAT
oct3/4 -2063/-1894 GGAACTGGGTGTGGGGAGGTTGTA AGCAGATTAAGGAAGGGCTAGGACGAGAG
oct3/4 -1377/-1129 TGCTCTGGGCTTTTTGAGGCTGTGTGATT TGGCGGAAAGACACTAAGGAGACGGGATT
oct3/4 -620/-378 TCTACCAACCTGGACAACACAAGATGGAA GCCACTCCTCAGTTCTTGCTTACCCAC
oct3/4 -237/+22 GTGAGGTGTCCGGTGACCCAAGGCAG CGGCTCACCTAGGGACGGTTTCACC
oct3/4 +1310/+1513 GGAGTCCCCTAGGAAGGCATTAATAGTTT GGATTCTCTCGGCTTCAGACAGACTTT