Skip to main content

Table 1 Primers used in q-RT-PCR analysis

From: Differential effects of AdOx on gene expression in P19 embryonal carcinoma cells

Gene Forward primer Reverse primer
ngn1 CCCTGAAGACGAGGTGAAAAGT CTTGCCATTGTATTGTCAGCCG
mash1 TAACTCCCAACCACTAACAGGC TGAGGAAAGACATCAACCCAGT
neuroD TTCCACGTCAAGCCGC TCGGCGGATGGTTCGT
sox2 CCACCAATCCCATCCA ACCGCCTAACGTACCACT
oct3/4 TCACTCACATCGCCAATCA GTAGCCTCATACTCTTCTCGTT
nanog GGCAGCCCTGATTCTTCTAC CGCTTGCACTTCATCCTTT
lin28 CGGCCAAAAGGGAAGAACAT CATTCCTTGGCATGATGGTCT
fgf4 GGCTTCGGCGGCTCTACT AGGATTCGTAGGCGTTGTAGTTG
utf1 TCCTCTTACGAGCACCGACAC GCAACGCGGTATTCAACGA
gata6 AACAGCAGTGGCTCTGTCCC CTCGGGGTTGGCGTTTT
sox17 TGGGCCAAAGACGAACG TTGGGGTGGTCCTGCATAT
hand1 CTACTTGATGGACGTGCTGG CAACTCCCTTTTCCGCTTG
brachyury CCAGTCTCTGGTCTGTGAGCA GGGGAGCCTCGAAAGAA
pax6 GTGAATGGGCGGAGTTATG ACTTGGACGGGAACTGACA
nestin TGAGAACTCTCGCTTGCAGAC GTATCCCAAGGAAATGCAGC
bmp4 CGAGCCAACACTGTGAGGA GAGGTTGAAGAGGAAACGAAA
cdx2 TCAGGAGGAAAAGTGAGCTG GGCTGTGGAGGCTGTTGTT
gapdh GAAGGTGAAGGTCGGAGTC GAAGATGGTGATGGGATTT