Skip to main content

Advertisement

Table 1 Primers used in this study

From: Gene structure and expression of serotonin receptor HTR2Cin hypothalamic samples from infanticidal and control sows

Primers for HTR2C amplification   
  forward reverse template size (bp)
Exon 1 TTTAGCCCAAGAGAGCGATG TAGGGTCTGGGCTAGCAATG genomic 637
Exon 2 TTCTGGCACTAATGAATATCAGC CATGGTAAGTCAATAACGTCAAATG genomic 315
Exon 3 CTGCATCCCCATTATGAGC TGGACCTTTCCTTGCATCTC genomic 300
Exon 4 AAATGAAAAATCTATCCTCTTTGC GGCAGATTGAGGCAAATATAGC genomic 413
Exon 5A ACTCTGGGGACAGGAGGAAG CTGCCATGATGACGAGAATG genomic 400
Exon 5B ATGGTGGACGCTTCAAATTC TGCGCACATTCAATTACCTC genomic 363
Exon 6 GCCCTAGAAAAGGCAAAATG TAGCCGCTGCAATTCTACTG genomic 463
Exon 7A ACCCTTCCGTGTGCTGTAAC CAAGCCTTCCCACAAAGAAC genomic 519
Exon 7B GAAAGCGTCGAAAGTCCTTG TCAACATTTTTGCATCGAAC genomic/cDNA 695
HTR2CX1-2 TTTAGCCCAAGAGAGCGATG TTGAAGGATGGGGATTCTTG cDNA 653
HTR2CX2-5 GTAGGCCAAGAATCCCCATC ACCAATAGGCCAATCAGGTG cDNA 263
HTR2CX4-5 CATGGTGAACCTGAGGAAAG GCAGAGACAGTGGCATGA cDNA 335
HTR2CX5-7 CATGCCACTGTCTCTGCTTG TGTTGTTGACGAACACCTTG cDNA 299/204
HTR2CNR   TTGCCCAAACAATAGCAATC cDNA  
HTR2CL TTCTACAGCGTCCATCATGC CACCTAAAGAAATTGCCCAAAC qRT-PCR 143
HTR2CS TGTCATGCCACTGTCTCTGC ACACCGATCCAGCGAAATAG qRT-PCR 145
  1. A list of primers used for PCR amplification of HTR2C exons from both genomic DNA, and cDNA prepared from a transcript pool. Primers were selected following comparison of human and porcine reference sequences to define the putative coding regions of the pig genome