Skip to main content

Table 1 Primers specific for Exon 13 and Duet

From: Kalrnplays key roles within and outside of the nervous system

Kalirin domain Oligo name Sequence Tm(°C) Length (nt)
Exon 13 Ex13-for CTCAGCGATGTCCAACAACAAGACACC 61 121
  Ex13-rev GAAGAGCTGTTTCACGAGCGGAAGATC 61  
Duet Duet-for CTGAAGTTTCCTACCGCCGCGC 60 122
  Duet-rev AGCCCAAAGAGGGACCTCGGG 60