Skip to main content

Advertisement

Table 2 Primers used in qRT-PCR

From: MiR-125b orchestrates cell proliferation, differentiation and migration in neural stem/progenitor cells by targeting Nestin

Gene symbol Primer sequence(5’-3’) Product size (bp)
Nestin (Homo Sapiens) Forward: TGGCAAAGGAGCCTACTCCAAGAA ; Reverse: ATCGGGATTCAGCTGACTTAGCCT 111
Nestin (Rattus Norvegicus) Forward: AGAGAAGCGCTGGAACAGAG; Reverse: AGGTGTCTGCAACCGAGAGT 234
Tuj1(Rattus Norvegicus) Forward: AGCAGATGCTGGCCATTCAGAGTA; Reverse: TAAACTGCTCGGAGATGCGCTTGA 174
Sox2 (Rattus Norvegicus) Forward: AAAGGAGAGAAGTTTGGAGCCCGA; Reverse: GGGCGAAGTGCAATTGGGATGAAA 113
Vimentin (Rattus Norvegicus) Forward: AGGTGGATCAGCTCACCAATGACA ; Reverse: TCAAGGTCAAGACGTGCCAGAGAA 184
Map2 (Rattus Norvegicus) Forward: GCAGCGCCAATGGATTTCCATACA ; Reverse: TCCGTTGATCCCGTTCTCTTTGGT 104
Gapdh(Homo Sapiens) Forward: CATGTTCGTCATGGGTGTGAACCA; Reverse: AGTGATGGCATGGACTGTGGTCAT 160
Gapdh(Rattus Norvegicus) Forward: AAGGGCTCATGACCACAGTC; Reverse: GTGAGCTTCCCATTCAGCTC 169