Skip to main content

Table 1 Primers used to construct luciferase reporter plasmids of Nestin

From: MiR-125b orchestrates cell proliferation, differentiation and migration in neural stem/progenitor cells by targeting Nestin

Gene name Primer sequence Product size (bp)
Nestin 3’UTR Forward/ SpeI: 5'- GGACTAGTGAAAAGACCATCTG -3' 431
(mir-125b sense) Reverse/ SphI:5'- ACATGCATGCAGGGCGTGCTACTG -3'
(mir-125b mutated 1 putative binding region) Reverse/ SphI:5'- CACCCGTAAGTCGGCAGTGCCGGGCAGATGG -3'
(mir-125b mutated 2 putative binding region) Reverse/ SphI: 5'- CCGGCCAGCCCTGTCAGCCAGAAACCATATGTCAA -3'