Skip to main content

Advertisement

Table 2 Primer sequences used in the experiment

From: The nestin-expressing and non-expressing neurons in rat basal forebrain display different electrophysiological properties and project to hippocampus

mRNA Accession no.a primer sequence Start position b Product sizec
ChAT (first round) XM_001061520 CAGGAAGGTCGGGTGGACAACATC TCCTTGGGTGCTGGTGGCTTG 1675 2198 524 bp
GAD67 (first round) NM_017007 TTTGGATATCATTGGTTTAGCTGGCGAAT TTTTTGCCTCTAAATCAGCTGGAATTATCT 762 1162 401 bp
VGLUT1 (first round) NM_053859 TACTGGAGAAGCGGCAGGAAGG CCAGAAAAAGGAGCCATGTATGAGG 188 498 311 bp
VGLUT2 (first round) NM_053427 CCCGCAAAGCATCCAACCA TGAGAGTAGCCAACAACCAGAAGCA 1264 1682 419 bp
Nestin (first round) M34384 CTCGGGAGTGTCGCTTAGAG ATTAGGCAAGGGGGAAGGGA 783 1216 434 bp
ChAT (second round) XM_001061520 ATGGCCATTGACAACCATCTTCTG CCTTGAACTGCAGAGGTCTCTCAT 1840 2163 324 bp
GAD67 (second round) NM_017007 CTGACATCAACTGCCAATACCAA GGAGAAAATATCCCATCACCATC 793 929 137 bp
VGLUT1 (second round) NM_053859 GTGGTGGACTGCACTTGCTT CATGTATGAGGCCGACAGTCTC 274 484 211 bp
VGLUT2 (second round) NM_053427 CGCAAAGCATCCAACCAT TGTGGGACCGCAGACAAC 1266 1529 264 bp
Nestin (second round) M34384 GGA GCA GGA GAA GCA AGG GGT CCA GAA AGC CAA GAG 931 1115 185 bp
  1. ChAT, choline acetyltransferase; GAD, glutamic acid decarboxylases; VGLUT, vesicular glutamate transporter. a The GenBank accession number for the cDNA sequence used in primer design; b The cDNA position of the 5'' end of primer; c Expected PCR product length.