Skip to main content

Advertisement

Table 2 Primer sequences used in the experiment

From: The nestin-expressing and non-expressing neurons in rat basal forebrain display different electrophysiological properties and project to hippocampus

mRNA Accession no.a primer sequence Start position b Product sizec
ChAT
(first round)
XM_001061520 CAGGAAGGTCGGGTGGACAACATC
TCCTTGGGTGCTGGTGGCTTG
1675
2198
524 bp
GAD67
(first round)
NM_017007 TTTGGATATCATTGGTTTAGCTGGCGAAT
TTTTTGCCTCTAAATCAGCTGGAATTATCT
762
1162
401 bp
VGLUT1
(first round)
NM_053859 TACTGGAGAAGCGGCAGGAAGG
CCAGAAAAAGGAGCCATGTATGAGG
188
498
311 bp
VGLUT2
(first round)
NM_053427 CCCGCAAAGCATCCAACCA
TGAGAGTAGCCAACAACCAGAAGCA
1264
1682
419 bp
Nestin
(first round)
M34384 CTCGGGAGTGTCGCTTAGAG
ATTAGGCAAGGGGGAAGGGA
783
1216
434 bp
ChAT
(second round)
XM_001061520 ATGGCCATTGACAACCATCTTCTG
CCTTGAACTGCAGAGGTCTCTCAT
1840
2163
324 bp
GAD67
(second round)
NM_017007 CTGACATCAACTGCCAATACCAA
GGAGAAAATATCCCATCACCATC
793
929
137 bp
VGLUT1
(second round)
NM_053859 GTGGTGGACTGCACTTGCTT
CATGTATGAGGCCGACAGTCTC
274
484
211 bp
VGLUT2
(second round)
NM_053427 CGCAAAGCATCCAACCAT
TGTGGGACCGCAGACAAC
1266
1529
264 bp
Nestin
(second round)
M34384 GGA GCA GGA GAA GCA AGG
GGT CCA GAA AGC CAA GAG
931
1115
185 bp
  1. ChAT, choline acetyltransferase; GAD, glutamic acid decarboxylases; VGLUT, vesicular glutamate transporter. a The GenBank accession number for the cDNA sequence used in primer design; b The cDNA position of the 5'' end of primer; c Expected PCR product length.