Skip to main content

Table 1 Primer sequences used for HMG-CoA reductase and β-actin.

From: Simvastatin protects auditory hair cells from gentamicin-induced toxicity and activates Akt signaling in vitro

Gene Primer name Sequence 5' → 3' Annealing temperature Exons Product length
HMG-CoA reductase Forward TGTTCAAGGGGCGTGCAAAGACAA 63 17 202 bp
  Reverse TCAAGCTGCCTTCTTGGTGCATGT   18  
β-actin Forward ACGGTCAGGTCATCACTATCGGCA 58 3 208 bp
  Reverse ATCCTGTCAGCAATGCCTGGGT   4