Skip to main content

Table 3 Primers used for site-directed mutagenesis.

From: A short upstream promoter region mediates transcriptional regulation of the mouse doublecortin gene in differentiating neurons

Mutated site Primer (5'- 3') Sequence Ref
pdcx Lef* Sense ATCTCTCTATGCCGTGTTTGTCTGAGCTCCAAGC [60]
  Antisense GCTTGGAGCTCAGACAAACACGGCATAGAGAGAT  
pdcx Hnf6* Sense AGGCATAGAGAGCGTTTGTTTCTTTCTCTCAGCATCTCCACCCAACC /
  Antisense GGTTGGGTGGAGATGCTGAGAGAAAGAAACAAACGCTCTCTATGCCT  
pdcx Nf-y 1 * Sense AGGCATAGAGAGCGGTTTTTTCTTTCTCTCAGCTCTCCACCC [61]
  Antisense GGGTGGAGAGCTGAGAGAAAGAAAAAACCGCTCTCTAGCCT  
pdcx Nf-y 2 * Sense CGTTGTTTCTGCTGGTTTTGGGTGGAGATGC [61]
  Antisense GCATCTCCACCCAAAACCAGCAGAAACAACG  
  1. PCR fragments carrying the mutation are obtained by annealing the following primers in the pdcx 249bp-Luc plasmid.