Skip to main content

Table 2 Primers used for PCR.

From: A short upstream promoter region mediates transcriptional regulation of the mouse doublecortin gene in differentiating neurons

Gene Sense primer (3' - 5') Antisense primer (3' - 5') Tm (°C) Ref
Dcx AAGTGACCAACAAGGCTATT TCATTGTGTTTTCTCCCGGA 60 [54]
Lef GAACGAGTCTGAAATCATCC GTAGGGATATCAGGAGCTGG 53 [55]
Tcf1 CATTCCTGGAGTCCTGAAGC CCTGTCAGTTACACCAACG 57 /
Tcf3 AGGAAATCACCAGTCACCGT GTACTTGGCCTGTTCTTCTC 55 [56]
Tcf4 TTCAAAGACGACGGCGAACAG TTGCTGTACGTGATAAGAGGCG 55 [56]
Hnf6 TTCCAGCGCATGTCGGCGCTC GGTACTAGTCCGTGGTTCTTC 55 [57]
Oc2 ATGCCGGTCTCAGGGGACTCTC GGCGAAGAGTGTTCGGCGTTGGAG 55 [58]
Nf-ya CTGGAGCCTCTGATTGGGT CTCTACAGATCCCAGGCAGC 55 [59]
Nf-yb AGGATCCACCACCTTTTTGA TAGCTGGGAGGCATCTGTG 55 [59]
Nf-yc TTTCTTCCATGACTCTGGGC GCTGCTTTCTTCGCTGGA 55 [59]
Gapdh ACCACAGTCCATGCCATCAC TCCACCACCCTGTTGCTGTA   
  1. All sequences were designed using the PRIMER 3 software http://frodo.wi.mit.edu/primer3/input.htm.