Skip to main content

Table 2 PCR Primers

From: Long descending cervical propriospinal neurons differ from thoracic propriospinal neurons in response to low thoracic spinal injury

Gene Symbol Accession # Left Primer Right Primer Product Size
Abcb5 XM_234725 CTGATAGAGCATGGCTTTGAATG GGTTGTTTTATGGCAGAGCAGA 77
Akt3 NM_031575 TGGAGAGGAAGAGATGGATGC TCCACTTGCCTTCTCTCGAAC 130
Arg1 NM_017134 TGGAACAATCAGTGTGGTGCT ATCCACCCAAATGACGCATAG 103
Atf3 NM_012912 AATTGCTGCTGCCAAGTGTC CAGTTCGGCATTCACACTCTC 94
Atg9a NM_001014218 CCTTTGCGCAGATGGACGTT ACAACTCGGTCTTCCCATCCT 107
Atg9b XM_575327 CATTCTACCCTCAGCCCAGT GAAGAGATTGCAGACCGAGC 121
Atrn NM_031351 CGTGTGGTCATGTTGGTCA GCACTAGAGCACCTTGAGTTTG 121
Casp2 NM_022522 GTGGAATGCATCCTGACCAT TAACAGTTCGCTCAGCAGCA 83
Crem S67786 CTGGCCAAATTTCTGTCCCTA ACACCTTGTGGCAAAGCAGTA 133
Dbh NM_013158 GGGATGTCCTCATCACTTCG GTGGCCATTGTCCTGTTTTC 55
Flna XM_238167 ACCAACCAACAGTGCAGACC TGTTTGCTGGCTACCCTGAG 80
Fuk XM_226508 AGAGCTCAGGCTCTAGGATGC ACACCACCCATTGCCTATGA 112
Grm4 NM_022666 CCAATGTGCCATCCTCAGA CCTACACCAACCATGCCATC 119
Itga6 XM_215984 GCCCTATGAACTTGGTGGAGA AATACCCTTCCCTGAGTCCACA 100
Itgb1 NM_017022 CCACAACAGCTGCTTCTAAAGTTG AATAGGGTAGTCTTCAGCCCTCTTG 84
Maob NM_013198 TGGTGGATCTGGTCAAGTGAG TCTCCTGTCTGGTCAATGTGG 96
Notch3 NM_008716 TGCAGGGTAGGCTTGGTATG TGTGTCCAGACTGGGGCTTA 79
Nrap NM_001107443 GGCGGCTCTTTTGGCTATC GGGCAGCAGAGAGGGAAAG 72
Oaz1 NM_139081 AGTCAGCGGGATCACAGTCTT AGGACCCTGGTCTTGTCGTTA 98
Pdgfra XM_214030 CGAAGGCAGGCACATTTATATC TATGATGGCACAATCGTCCTCT 109
Pycard NM_172322 GCATACAGGAGCTGGCTGA CAATGAGTGCTTGCCTGTGT 135
Rhoq NM_053522 CTATGCTAACGACGCCTTCC GATAAAGGCCTCAGACGATCA 147
Sat NM_001007667 TGACCCATGGATTGGCAAGT GCAGCGACACTTCATAGCAA 124
Slc27a3 XM_215605 CAGCTCCCCAATGTACTGGA TAGGGGCCACTGTGGTACTG 101
Slc6a11 NM_024372 CCCGTCTTCTTCCTGGAAAC GGACAGACTCTCCTCCAGCA 77
Tgfbr1 NM_012775 TTCATTTCAGAGGGCACCAC CAATGGTCCTTGCAATTGTTC 109
Xiap NM_022231 GAATATGACGCACGGATCGTT CCTCCTCCACAGTGAAAGCAC 128
Zfp53 XM_344861 GCAAACAAGCTGCAGAGTCA TGAGGCGGTACTGAAGCATT 132
  1. PCR Primer Table. Primer sequences for all of the custom designed PCR primers used in this study. Primers were designed using the Primer3 software and synthesized by Eurofins MWG Operon (see Methods)