Skip to main content

Table 1 Primers used in real time quantitative PCR

From: Gap junctions in olfactory neurons modulate olfactory sensitivity

Genes Primer pairs
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) Forward: GTGGACCTCATGGCCTACAT
Reverse: TGTGAGGGAGATGCTCAGTG
Olfactory marker protein (OMP) Forward: CCGCCGCCATCTTCTG
Reverse: CGTCTGCCTCATTCCAATCC
GTP-binding protein Golf alpha subunit (Golf) Forward: TTTGGGCAACAGCAGCAA
Reverse: CTCGCGGCGTCCTTTTTC
Growth associated protein 43 (Gap43) Forward: ACCACCATGCTGTGCTGTATG
Reverse: TCAATCTTTTGGTCCTCATCATTC
Cytochrome P450, family 2, subfamily A (CYP2A) Forward: GCTGGGAAGCTTCCAGTTCAC
Reverse: GGCCCTGCAGCTCCTTAAA
I7 olfactory receptor (I7) Forward: TAAGGCACTCTCAGCTTTTGACA
Reverse: GAGTGCGACGT AGGGCTTT
Connexin 36 (Cx36) Forward: GAGGTTAAAGAGCTGACTCCACATC
Reverse: TCGGAGCTTGGACCTTGCT
Connexin 43, 3' untranslated region (Cx43-3U) Forward: AAAGATTGCCCATGTATTTGCA
Reverse: GACACAAAGGTGGGACAGATTTG
Connexin 45 (Cx45) Forward: ACAGTGTTCCCAGGCACATG
Reverse: CTGGAAGACACAACCTGAAAGTTCT
Connexin 57 (Cx57) Forward: GAAGTCGCAAGGCCAGCTT
Reverse: CACTATGCCGTTGTCCCTTTTC
\