Skip to main content

Table 2 PCR primers used in this study

From: Tissue-specific and neural activity-regulated expression of human BDNF gene in BAC transgenic mice

Primer/application Sequence
BAC modification  
hBDNFcod_rpsL_neo_s 5' GGATAGACACTTCTTGTGTATGTACATTGACCATTAAA AGGGGAAGATAGGGCCTGGTGATGATGGCGGGATCG 3'
hBDNF_rpsL_neo_as 5'AATAGATAATTTTTGTCTCAATATAATCTAATCTATACAACATAAATCCATCAGAAGAACTCGTCAAGAAGG 3'
hBDNFcod_linker_EGFP_s 5' TAAGGATAGACACTTCTTGTGTATGTACATTGACCAT TAAAAGGGGAAGACGGGATCCACCGGTCGCCACCATGGTGAGCAAGGGCGAGGAGCTG 3'
hBDNF_EGFP_as 5' AATAGATAATTTTTGTCTCAATATAATCTAATCTATAC AACATAAATCCATTACTTGTACAGCTCGTCCATGCCGA 3'
genotyping/slot-blot hybridization/expression analysis
hBDNF_s GTACGTGCGGGCCCTTACCATGGATAGC
EGFP_as TGGTGCAGATGAACTTCAGGGTCAGC
expression analysis
mBDNF_s GTATGTTCGGGCCCTTACTATGGATAGC
mBDNF_as AAGTTGTGCGCAAATGACTGTTTC
HPRT1_s CTTTGCTGACCTGCTGGATTAC
HPRT1_as GTCCTTTTCACCAGCAAGCTTG
hBDNF_I_s GATGCCAGTTGCTTTGTCTTCTGTAG
hBDNF_II_s GGGCGATAGGAGTCCATTCAGCACC
hBDNF_III_s AGTTTCGGGCGCTGGCTTAGAG
hBDNF_IV_s GCTGCAGAACAGAAGGAGTACA
hBDNF_V_s TCGCGTTCGCAAGCTCCGTAGTG
hBDNF_Vh_s GGCTGGAACACCCCTCGAA
hBDNF_VI_s GGCTTTAATGAGACACCCACCGC
hBDNF_VII_s GAACTGAAAGGGTCTGCGACACTCT
hBDNF_IXb_s GCTGCTAAAGTGGGAAGAAGG
hBDNF_IX_as1 GTCCTCATCCAACAGCTCTTCTATC
hBDNF_IX_as2 (with VII_s) GAAGTGTACAAGTCCGCGTCCTTA
expression analyis (qPCR)
EGFPq_s CAGAAGAACGGCATCAAGGTG
EGFPq_as TGGGTGCTCAGGTAGTGGTTG
hBDNFq_I_s CAGCATCTGTTGGGGAGACGAGA
hBDNFq_IV_s GAAGTCTTTCCCGGAGCAGCT
hBDNFq_VI_s ATCGGAACCACGATGTGACT
hBDNFq_IXc_s AACCTTGACCCTGCAGAATGGCCT
hBDNFq_IX_as1 (with I, IV_s) ATGGGGGCAGCCTTCATGCA
hBDNFq_IX_as2 (with VI_s) ACCTTGTCCTCGGATGTTTG
hBDNFq_IX_as3 (with IXc_s) GATGGTCATCACTCTTCTCACCT
mBDNFq_I_s TTGAAGCTTTGCGGATATTGCG
mBDNFq_IV_s GAAATATATAGTAAGAGTCTAGAACCTTG
mBDNFq_VI_s GCTTTGTGTGGACCCTGAGTTC
mBDNFq_IXa_s GGACTATGCTGCTGACTTGAAAGGA
mBDNFq_IX_as1 (with I, IV, VIs) AAGTTGCCTTGTCCGTGGAC
mBDNFq_IX_as2 (with IXa_s) GAGTAAACGGTTTCTAAGCAAGTG
mBDNFq_coding_s GGCCCAACGAAGAAAACCAT
mBDNFq_coding_s AGCATCACCCGGGAAGTGT
HPRT1q_s CAGTCCCAGCGTCGTGATTA
HPRT1q_as AGCAAGTCTTTCAGTCCTGTC
transgene integrity
pBACe3.6_SP6 (5'end) TATTTAGGTGACACTATAG
rp11_5'_as (5'end) GGACAACAGACCCAAGGAGA
rp11_3'_s (3'end) GTAGGGTGTCTGGGTTGGTG
pBACe3.6_T7 (3'end) TAATACGACTCACTATAGGG
transgene tandem integration
rp11_3'_s (P1) GTAGGGTGTCTGGGTTGGTG
pBACe_11326_s (P2) CGGTTACGGTTGAGTAATAAATGGATG
pBACe_11365_s (P3) GGGGCACATTTCATTACCTCTTTCTC