Skip to main content

Table 2 Primer sequences for quantitative real-time PCR

From: Expression of iron-related genes in human brain and brain tumors

Gene Forward primer (5'-3') Reverse promer (5'-3')
HPRT1* TGACACTGGCAAAACAATGCA GGTCCTTTCACCACAAGCT
GAPDH* TGCACCACCAACTGCTTAGC GGCATGGACTGTGGTCATGAG
UBC* ATTTGGGTCGCGGTTCTTG TGCCTTGACATTCTCGATGGT
TBP TGCACAGGAGCCAAGAGTGAA CACATCACAGCTCCCCACCA
HFE CAACAAGTGCCTCCTTTGGT GGGGGTACAGCCAAGGTTAT
HAMP CCACAACAGACGGGACAAC CTTGCAGCACATCCCACAC
NEO1 GCTGGAAGGCGAGGAATGA CGGGTGGTAGAGATGACTG
TFRC CTTTGGACATGCTCATCTGG TGTTTTCCAGTCAGAGGGACA
TFR2 TGGAGGACACCATCAGGCAA AGCTGCTCTCCGACCTTCC
HFE2** GGAGAATTGGATAGCAGAG AGCAGCAGGAGAGTGAGA
B2M** TCCAGCGTACTCCAAAGATTCAGG ATGCGGCATCTTCAAACCTCC
  1. * Primer sequences first described in [22]
  2. ** Primers used for RT-PCR only