Skip to main content

Table 2 Sequences of primer pairs and probes used for the real-time RT-PCR

From: Effects of dietary Na+ deprivation on epithelial Na+ channel (ENaC), BDNF, and TrkB mRNA expression in the rat tongue

Gene
GenBank Accession #
Sequence 5'-3' Fragment
size (bp)
α rENaC (NM_031548)   96
Forward primer GAGTCTCCTTCTGTCACGATGG  
Reverse primer CATCTCCACCACAGAGAGCAC  
TaqMan probe CCAAACCACAGGCTCCACTGGCTGC  
β rENaC (x77932)   99
Forward primer CCAATGGGACCGTGTGTACC  
Reverse primer GCACTTGTGAGAAGATGTTGGTG  
TaqMan probe CCGAAACTTCACCAGTGCCACCCAGG  
γ rENaC (NM_017046)   106
Forward primer AGCCAAGGTGCTTATCCATCAG  
Reverse primer TTCTGTCAGGTGCATTCCTATGG  
TaqMan probe CATTGCTGTCTCGATCTCCATCCCCACG  
rBDNF (NM_012513)   97
Forward primer TCAGCAGTCAAGTGCCTTTGG  
Reverse primer CGCCGAACCCTCATAGACATG  
TaqMan probe CCTCCTCTGCTCTTTCTGCTGGAGGAATACAA  
rTrkB (M55292)   100
Forward primer TTTGTGGCTTACAAGGCGTTTC  
Reverse primer GGTGGCGGAAATGTCTCCTG  
TaqMan probe AAGAACGGCAACCTGCGGCACATCAA